Incidental Mutation 'R6232:Tbc1d23'
ID504710
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene NameTBC1 domain family, member 23
Synonyms4930451A13Rik, D030022P07Rik
MMRRC Submission 044360-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R6232 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location57168862-57231504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57170433 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 661 (I661V)
Ref Sequence ENSEMBL: ENSMUSP00000023431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000023432] [ENSMUST00000226586]
Predicted Effect probably benign
Transcript: ENSMUST00000023431
AA Change: I661V

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749
AA Change: I661V

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023432
SMART Domains Protein: ENSMUSP00000023432
Gene: ENSMUSG00000022751

DomainStartEndE-ValueType
Pfam:CN_hydrolase 5 256 3.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180999
Predicted Effect probably benign
Transcript: ENSMUST00000226586
AA Change: I676V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232573
Meta Mutation Damage Score 0.2178 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5134 T A 10: 75,986,025 L231Q possibly damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Muc16 A T 9: 18,656,998 N1408K unknown Het
Myh7 T A 14: 54,989,296 Q366L probably benign Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Olfr697 A T 7: 106,741,554 C127S probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pkp1 T A 1: 135,886,861 I241F probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Sec63 T A 10: 42,828,865 probably null Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 57171776 missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57192675 missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57186685 splice site probably benign
IGL01980:Tbc1d23 APN 16 57189252 splice site probably benign
IGL02457:Tbc1d23 APN 16 57170391 missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57184415 missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57214262 missense probably damaging 1.00
R0386:Tbc1d23 UTSW 16 57189273 missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 57171814 missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R1124:Tbc1d23 UTSW 16 57214162 critical splice donor site probably null
R1430:Tbc1d23 UTSW 16 57214210 missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 57173100 missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57189351 missense probably benign
R4675:Tbc1d23 UTSW 16 57182962 missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57198895 frame shift probably null
R4781:Tbc1d23 UTSW 16 57218415 missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57192628 missense probably benign 0.01
R4895:Tbc1d23 UTSW 16 57198857 critical splice donor site probably null
R5389:Tbc1d23 UTSW 16 57198928 missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57198309 missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 57173150 missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57231350 missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57182903 missense probably damaging 0.98
R6484:Tbc1d23 UTSW 16 57178016 missense probably damaging 1.00
R6670:Tbc1d23 UTSW 16 57214217 missense probably benign 0.00
R6957:Tbc1d23 UTSW 16 57208323 missense probably damaging 1.00
R7218:Tbc1d23 UTSW 16 57170382 missense probably damaging 1.00
R7601:Tbc1d23 UTSW 16 57181534 missense probably benign 0.10
R7877:Tbc1d23 UTSW 16 57173125 missense probably benign 0.35
R7886:Tbc1d23 UTSW 16 57189383 missense possibly damaging 0.95
R8202:Tbc1d23 UTSW 16 57191554 missense probably damaging 1.00
Z1177:Tbc1d23 UTSW 16 57182975 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATGAGCAAATCAAAGGTCTC -3'
(R):5'- AGCAAGGACGGTGATTTACC -3'

Sequencing Primer
(F):5'- GAGCAAATCAAAGGTCTCTGCTTAG -3'
(R):5'- GGACATCACACATACTTAGTAGTTG -3'
Posted On2018-02-28