Incidental Mutation 'R6233:Olfr1152'
ID504728
Institutional Source Beutler Lab
Gene Symbol Olfr1152
Ensembl Gene ENSMUSG00000045225
Gene Nameolfactory receptor 1152
SynonymsMOR177-12, GA_x6K02T2Q125-49372426-49373358
MMRRC Submission 044361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6233 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87866492-87874156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87868560 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000151045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051058] [ENSMUST00000213308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051058
AA Change: S190P

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054645
Gene: ENSMUSG00000045225
AA Change: S190P

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-46 PFAM
Pfam:7tm_1 40 290 1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121994
Predicted Effect possibly damaging
Transcript: ENSMUST00000213308
AA Change: S190P

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,965 T300A probably benign Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acvr1 T A 2: 58,448,399 N437I probably benign Het
Adgrg7 T A 16: 56,778,642 T57S possibly damaging Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
AI481877 T A 4: 59,076,245 D566V possibly damaging Het
Ankrd9 A T 12: 110,977,120 I160N probably damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Clmn A C 12: 104,785,455 L247R probably damaging Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dmkn C A 7: 30,779,679 A280E probably damaging Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsc3 C T 18: 19,965,795 G776R possibly damaging Het
Eefsec A G 6: 88,358,544 probably null Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eny2 A G 15: 44,433,660 probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fbxo28 A G 1: 182,341,508 S22P unknown Het
Fcrlb A G 1: 170,908,889 I106T probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm4756 T C 12: 72,619,567 Y110C probably damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Gm884 A T 11: 103,613,388 L2585I probably damaging Het
Gna12 A G 5: 140,760,692 F333L possibly damaging Het
Gria2 A G 3: 80,707,203 I510T probably damaging Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Il1rap A G 16: 26,710,506 T310A probably benign Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kcnk4 T C 19: 6,928,329 N90S probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lamc1 A T 1: 153,223,666 D1520E probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myh7b C T 2: 155,631,799 A1584V possibly damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1474 T C 19: 13,471,740 Y257H probably damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Olfr799 T C 10: 129,647,296 M56T probably benign Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pilra T C 5: 137,823,501 T291A possibly damaging Het
Ppp1r9a G T 6: 5,077,610 D630Y probably damaging Het
Pros1 A C 16: 62,898,921 Q102P possibly damaging Het
Rad21l T C 2: 151,653,542 D407G probably benign Het
Rapgef5 G A 12: 117,739,718 probably null Het
Rbm25 G A 12: 83,659,426 A182T probably benign Het
Rnf13 A G 3: 57,832,970 E236G possibly damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Sdr16c6 T A 4: 4,069,984 I119F probably damaging Het
Slc12a7 T C 13: 73,805,471 S767P possibly damaging Het
Slc23a1 A G 18: 35,624,444 I258T probably damaging Het
Spata13 G A 14: 60,692,007 R338H probably benign Het
Sufu G A 19: 46,475,632 G428R probably damaging Het
Sult2a1 T C 7: 13,832,675 D125G probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tenm3 A C 8: 48,417,059 V233G probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tspan11 T C 6: 127,938,264 Y114H probably damaging Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Usp44 G A 10: 93,850,340 C539Y probably damaging Het
Vmn2r73 G A 7: 85,869,891 P508S probably benign Het
Zfp831 A G 2: 174,646,697 D1055G possibly damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Olfr1152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Olfr1152 APN 2 87868465 missense probably benign 0.00
IGL01618:Olfr1152 APN 2 87868144 missense probably damaging 0.96
IGL02326:Olfr1152 APN 2 87868675 missense probably damaging 1.00
IGL03162:Olfr1152 APN 2 87868140 missense probably benign 0.00
IGL03189:Olfr1152 APN 2 87868215 missense possibly damaging 0.76
I2288:Olfr1152 UTSW 2 87868135 missense probably damaging 1.00
R0761:Olfr1152 UTSW 2 87868536 missense possibly damaging 0.88
R1558:Olfr1152 UTSW 2 87868115 missense probably damaging 1.00
R1938:Olfr1152 UTSW 2 87868461 missense probably benign 0.01
R3810:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R3812:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R4728:Olfr1152 UTSW 2 87868435 missense probably benign 0.13
R4928:Olfr1152 UTSW 2 87868230 missense probably benign 0.32
R5172:Olfr1152 UTSW 2 87868827 missense probably benign 0.20
R5174:Olfr1152 UTSW 2 87868411 missense possibly damaging 0.79
R6147:Olfr1152 UTSW 2 87868717 missense probably benign 0.03
R6195:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6541:Olfr1152 UTSW 2 87868294 missense probably benign 0.11
R7507:Olfr1152 UTSW 2 87868369 missense probably damaging 1.00
R8068:Olfr1152 UTSW 2 87868651 missense not run
Predicted Primers PCR Primer
(F):5'- TGATCGGTACAAGGCAATCAGC -3'
(R):5'- TCCCTGGAAAATTGCAACTGC -3'

Sequencing Primer
(F):5'- TCCAGCAAGGTGTGTTAC -3'
(R):5'- CTGCAGTTAAATGAGAGGTGC -3'
Posted On2018-02-28