Incidental Mutation 'R6233:Rsrp1'
ID 504740
Institutional Source Beutler Lab
Gene Symbol Rsrp1
Ensembl Gene ENSMUSG00000037266
Gene Name arginine/serine rich protein 1
Synonyms D4Ucla2, D4Wsu53e, 2700043I21Rik
MMRRC Submission 044361-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6233 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 134650936-134654681 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134654113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 255 (I255K)
Ref Sequence ENSEMBL: ENSMUSP00000077226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030622] [ENSMUST00000078084]
AlphaFold Q3UC65
Predicted Effect probably benign
Transcript: ENSMUST00000030622
SMART Domains Protein: ENSMUSP00000030622
Gene: ENSMUSG00000028821

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:SYF2 89 237 9.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078084
AA Change: I255K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077226
Gene: ENSMUSG00000037266
AA Change: I255K

DomainStartEndE-ValueType
Pfam:RSRP 6 298 5.9e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154837
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T A 2: 58,338,411 (GRCm39) N437I probably benign Het
Adam34l T G 8: 44,078,949 (GRCm39) N425T probably benign Het
Adgrg7 T A 16: 56,599,005 (GRCm39) T57S possibly damaging Het
Agbl2 T A 2: 90,643,657 (GRCm39) D792E probably benign Het
Ankrd9 A T 12: 110,943,554 (GRCm39) I160N probably damaging Het
Aoc1l2 A G 6: 48,907,899 (GRCm39) T300A probably benign Het
Baz2b T A 2: 59,737,855 (GRCm39) Q1818L possibly damaging Het
Bod1 A G 11: 31,616,740 (GRCm39) *174Q probably null Het
Cacna1a A G 8: 85,315,382 (GRCm39) Y1539C probably damaging Het
Clmn A C 12: 104,751,714 (GRCm39) L247R probably damaging Het
Cyp1b1 G T 17: 80,021,695 (GRCm39) L16M probably damaging Het
Dhrs7l T C 12: 72,666,341 (GRCm39) Y110C probably damaging Het
Dhx29 T A 13: 113,101,071 (GRCm39) S1205T probably benign Het
Dmkn C A 7: 30,479,104 (GRCm39) A280E probably damaging Het
Dnah7b G A 1: 46,243,429 (GRCm39) D1578N probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dsc3 C T 18: 20,098,852 (GRCm39) G776R possibly damaging Het
Eefsec A G 6: 88,335,526 (GRCm39) probably null Het
Efhb A G 17: 53,769,580 (GRCm39) F243S possibly damaging Het
Eif2ak2 A T 17: 79,178,662 (GRCm39) Y137* probably null Het
Eny2 A G 15: 44,297,056 (GRCm39) probably null Het
F2rl3 A G 8: 73,489,513 (GRCm39) T247A probably benign Het
Fan1 A T 7: 64,004,119 (GRCm39) H782Q probably damaging Het
Fbxo28 A G 1: 182,169,073 (GRCm39) S22P unknown Het
Fcgbpl1 T C 7: 27,830,885 (GRCm39) C33R probably damaging Het
Fcrlb A G 1: 170,736,458 (GRCm39) I106T probably damaging Het
Fer1l5 T C 1: 36,414,367 (GRCm39) probably null Het
Fgfbp1 T C 5: 44,136,704 (GRCm39) D196G possibly damaging Het
Gab1 A T 8: 81,606,161 (GRCm39) Y24* probably null Het
Gcc2 T C 10: 58,106,806 (GRCm39) S681P probably damaging Het
Git2 T C 5: 114,905,175 (GRCm39) N94S probably benign Het
Gm5799 T G 14: 43,782,088 (GRCm39) L87V probably damaging Het
Gna12 A G 5: 140,746,447 (GRCm39) F333L possibly damaging Het
Gria2 A G 3: 80,614,510 (GRCm39) I510T probably damaging Het
Hace1 T A 10: 45,546,539 (GRCm39) I391N possibly damaging Het
Il1rap A G 16: 26,529,256 (GRCm39) T310A probably benign Het
Itpr3 T C 17: 27,305,934 (GRCm39) I164T probably damaging Het
Kcnk4 T C 19: 6,905,697 (GRCm39) N90S probably benign Het
Krt40 G A 11: 99,433,920 (GRCm39) A22V possibly damaging Het
Lamc1 A T 1: 153,099,412 (GRCm39) D1520E probably benign Het
Lrrc37 A T 11: 103,504,214 (GRCm39) L2585I probably damaging Het
Mipep T A 14: 61,109,554 (GRCm39) W644R probably damaging Het
Mycl A G 4: 122,893,713 (GRCm39) D171G probably damaging Het
Myh7b C T 2: 155,473,719 (GRCm39) A1584V possibly damaging Het
Nf1 A G 11: 79,456,801 (GRCm39) Y629C probably damaging Het
Obscn T A 11: 58,888,033 (GRCm39) E2164V probably damaging Het
Or52h1 A T 7: 103,828,961 (GRCm39) V218D possibly damaging Het
Or5b118 T C 19: 13,449,104 (GRCm39) Y257H probably damaging Het
Or5w19 T C 2: 87,698,904 (GRCm39) S190P possibly damaging Het
Or6c209 T C 10: 129,483,165 (GRCm39) M56T probably benign Het
Or8k25 T C 2: 86,243,551 (GRCm39) I282V probably damaging Het
Pcdh20 T C 14: 88,705,488 (GRCm39) E604G probably benign Het
Pilra T C 5: 137,821,763 (GRCm39) T291A possibly damaging Het
Ppp1r9a G T 6: 5,077,610 (GRCm39) D630Y probably damaging Het
Pros1 A C 16: 62,719,284 (GRCm39) Q102P possibly damaging Het
Rad21l T C 2: 151,495,462 (GRCm39) D407G probably benign Het
Rapgef5 G A 12: 117,703,453 (GRCm39) probably null Het
Rbm25 G A 12: 83,706,200 (GRCm39) A182T probably benign Het
Rnf13 A G 3: 57,740,391 (GRCm39) E236G possibly damaging Het
Robo3 T G 9: 37,332,225 (GRCm39) Y891S probably damaging Het
Scn1a T A 2: 66,107,962 (GRCm39) Y1588F possibly damaging Het
Sdr16c6 T A 4: 4,069,984 (GRCm39) I119F probably damaging Het
Shoc1 T A 4: 59,076,245 (GRCm39) D566V possibly damaging Het
Slc12a7 T C 13: 73,953,590 (GRCm39) S767P possibly damaging Het
Slc23a1 A G 18: 35,757,497 (GRCm39) I258T probably damaging Het
Spata13 G A 14: 60,929,456 (GRCm39) R338H probably benign Het
Sufu G A 19: 46,464,071 (GRCm39) G428R probably damaging Het
Sult2a1 T C 7: 13,566,600 (GRCm39) D125G probably damaging Het
Tapbp T C 17: 34,138,956 (GRCm39) L41P probably damaging Het
Tbc1d16 T A 11: 119,101,391 (GRCm39) K40* probably null Het
Tdrd6 A G 17: 43,940,643 (GRCm39) V135A probably damaging Het
Tenm3 A C 8: 48,870,094 (GRCm39) V233G probably damaging Het
Tmem87a A T 2: 120,222,656 (GRCm39) probably null Het
Tspan11 T C 6: 127,915,227 (GRCm39) Y114H probably damaging Het
Ttn T A 2: 76,567,997 (GRCm39) Y27632F probably benign Het
Usp44 G A 10: 93,686,202 (GRCm39) C539Y probably damaging Het
Vmn2r73 G A 7: 85,519,099 (GRCm39) P508S probably benign Het
Zfp831 A G 2: 174,488,490 (GRCm39) D1055G possibly damaging Het
Zfp871 CCACAC CC 17: 32,994,494 (GRCm39) probably null Het
Other mutations in Rsrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Rsrp1 APN 4 134,651,290 (GRCm39) missense unknown
IGL03065:Rsrp1 APN 4 134,651,700 (GRCm39) missense possibly damaging 0.95
R0735:Rsrp1 UTSW 4 134,651,568 (GRCm39) missense unknown
R1863:Rsrp1 UTSW 4 134,651,388 (GRCm39) missense unknown
R4670:Rsrp1 UTSW 4 134,651,488 (GRCm39) missense unknown
R5705:Rsrp1 UTSW 4 134,651,331 (GRCm39) missense unknown
R6020:Rsrp1 UTSW 4 134,651,692 (GRCm39) missense probably damaging 0.97
R6195:Rsrp1 UTSW 4 134,654,113 (GRCm39) missense probably damaging 1.00
R7896:Rsrp1 UTSW 4 134,651,274 (GRCm39) missense unknown
R8143:Rsrp1 UTSW 4 134,654,319 (GRCm39) missense probably benign 0.13
R8695:Rsrp1 UTSW 4 134,652,610 (GRCm39) missense probably damaging 0.99
RF013:Rsrp1 UTSW 4 134,651,266 (GRCm39) missense unknown
X0021:Rsrp1 UTSW 4 134,654,070 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGGCTAATTGGAAAACAGGC -3'
(R):5'- AACAGCAGCTTTAGTTGTTTTCTGC -3'

Sequencing Primer
(F):5'- GCTCTTTAACTGTGACAATAGATGG -3'
(R):5'- CAGTGGCTTTGCTACGGAATTC -3'
Posted On 2018-02-28