Incidental Mutation 'R6233:Tenm3'
ID504756
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 044361-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R6233 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 48417059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 233 (V233G)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110343] [ENSMUST00000110345] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000211976]
Predicted Effect probably damaging
Transcript: ENSMUST00000033965
AA Change: V233G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: V233G

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110343
SMART Domains Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110345
SMART Domains Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110346
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190840
AA Change: V233G
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: V233G

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211976
Meta Mutation Damage Score 0.2785 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,965 T300A probably benign Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acvr1 T A 2: 58,448,399 N437I probably benign Het
Adgrg7 T A 16: 56,778,642 T57S possibly damaging Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
AI481877 T A 4: 59,076,245 D566V possibly damaging Het
Ankrd9 A T 12: 110,977,120 I160N probably damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Clmn A C 12: 104,785,455 L247R probably damaging Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dmkn C A 7: 30,779,679 A280E probably damaging Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsc3 C T 18: 19,965,795 G776R possibly damaging Het
Eefsec A G 6: 88,358,544 probably null Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eny2 A G 15: 44,433,660 probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fbxo28 A G 1: 182,341,508 S22P unknown Het
Fcrlb A G 1: 170,908,889 I106T probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm4756 T C 12: 72,619,567 Y110C probably damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Gm884 A T 11: 103,613,388 L2585I probably damaging Het
Gna12 A G 5: 140,760,692 F333L possibly damaging Het
Gria2 A G 3: 80,707,203 I510T probably damaging Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Il1rap A G 16: 26,710,506 T310A probably benign Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kcnk4 T C 19: 6,928,329 N90S probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lamc1 A T 1: 153,223,666 D1520E probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myh7b C T 2: 155,631,799 A1584V possibly damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr1474 T C 19: 13,471,740 Y257H probably damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Olfr799 T C 10: 129,647,296 M56T probably benign Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pilra T C 5: 137,823,501 T291A possibly damaging Het
Ppp1r9a G T 6: 5,077,610 D630Y probably damaging Het
Pros1 A C 16: 62,898,921 Q102P possibly damaging Het
Rad21l T C 2: 151,653,542 D407G probably benign Het
Rapgef5 G A 12: 117,739,718 probably null Het
Rbm25 G A 12: 83,659,426 A182T probably benign Het
Rnf13 A G 3: 57,832,970 E236G possibly damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Sdr16c6 T A 4: 4,069,984 I119F probably damaging Het
Slc12a7 T C 13: 73,805,471 S767P possibly damaging Het
Slc23a1 A G 18: 35,624,444 I258T probably damaging Het
Spata13 G A 14: 60,692,007 R338H probably benign Het
Sufu G A 19: 46,475,632 G428R probably damaging Het
Sult2a1 T C 7: 13,832,675 D125G probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tspan11 T C 6: 127,938,264 Y114H probably damaging Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Usp44 G A 10: 93,850,340 C539Y probably damaging Het
Vmn2r73 G A 7: 85,869,891 P508S probably benign Het
Zfp831 A G 2: 174,646,697 D1055G possibly damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7926:Tenm3 UTSW 8 48229111 nonsense probably null
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTAGTGAGAAAAGCGTTGG -3'
(R):5'- CAGCTCTGCAAGAAAAGTGGC -3'

Sequencing Primer
(F):5'- CGTTGGGCTAGTTTATTTTTGAAC -3'
(R):5'- CTCTGCAAGAAAAGTGGCAGTGC -3'
Posted On2018-02-28