Incidental Mutation 'R6233:Hace1'
ID504761
Institutional Source Beutler Lab
Gene Symbol Hace1
Ensembl Gene ENSMUSG00000038822
Gene NameHECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
SynonymsA730034A22Rik, 1700042J16Rik
MMRRC Submission 044361-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R6233 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location45577829-45712345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45670443 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 391 (I391N)
Ref Sequence ENSEMBL: ENSMUSP00000039206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037044
AA Change: I391N

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039206
Gene: ENSMUSG00000038822
AA Change: I391N

DomainStartEndE-ValueType
ANK 64 93 3.23e-4 SMART
ANK 97 126 7.76e-7 SMART
ANK 130 159 8.26e-2 SMART
ANK 163 192 1.94e-7 SMART
ANK 196 227 1.65e-1 SMART
ANK 228 257 5.98e1 SMART
Blast:HECTc 372 522 7e-87 BLAST
HECTc 572 909 1.76e-138 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131406
SMART Domains Protein: ENSMUSP00000118554
Gene: ENSMUSG00000038822

DomainStartEndE-ValueType
HECTc 7 300 2.63e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150511
SMART Domains Protein: ENSMUSP00000117985
Gene: ENSMUSG00000038822

DomainStartEndE-ValueType
HECTc 55 329 1.76e-74 SMART
Meta Mutation Damage Score 0.2441 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HECT domain and ankyrin repeat-containing ubiquitin ligase. The encoded protein is involved in specific tagging of target proteins, leading to their subcellular localization or proteasomal degradation. The protein is a potential tumor suppressor and is involved in the pathophysiology of several tumors, including Wilm's tumor. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,965 T300A probably benign Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acvr1 T A 2: 58,448,399 N437I probably benign Het
Adgrg7 T A 16: 56,778,642 T57S possibly damaging Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
AI481877 T A 4: 59,076,245 D566V possibly damaging Het
Ankrd9 A T 12: 110,977,120 I160N probably damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Clmn A C 12: 104,785,455 L247R probably damaging Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dmkn C A 7: 30,779,679 A280E probably damaging Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsc3 C T 18: 19,965,795 G776R possibly damaging Het
Eefsec A G 6: 88,358,544 probably null Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eny2 A G 15: 44,433,660 probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fbxo28 A G 1: 182,341,508 S22P unknown Het
Fcrlb A G 1: 170,908,889 I106T probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm4756 T C 12: 72,619,567 Y110C probably damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Gm884 A T 11: 103,613,388 L2585I probably damaging Het
Gna12 A G 5: 140,760,692 F333L possibly damaging Het
Gria2 A G 3: 80,707,203 I510T probably damaging Het
Il1rap A G 16: 26,710,506 T310A probably benign Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kcnk4 T C 19: 6,928,329 N90S probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lamc1 A T 1: 153,223,666 D1520E probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myh7b C T 2: 155,631,799 A1584V possibly damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr1474 T C 19: 13,471,740 Y257H probably damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Olfr799 T C 10: 129,647,296 M56T probably benign Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pilra T C 5: 137,823,501 T291A possibly damaging Het
Ppp1r9a G T 6: 5,077,610 D630Y probably damaging Het
Pros1 A C 16: 62,898,921 Q102P possibly damaging Het
Rad21l T C 2: 151,653,542 D407G probably benign Het
Rapgef5 G A 12: 117,739,718 probably null Het
Rbm25 G A 12: 83,659,426 A182T probably benign Het
Rnf13 A G 3: 57,832,970 E236G possibly damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Sdr16c6 T A 4: 4,069,984 I119F probably damaging Het
Slc12a7 T C 13: 73,805,471 S767P possibly damaging Het
Slc23a1 A G 18: 35,624,444 I258T probably damaging Het
Spata13 G A 14: 60,692,007 R338H probably benign Het
Sufu G A 19: 46,475,632 G428R probably damaging Het
Sult2a1 T C 7: 13,832,675 D125G probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tenm3 A C 8: 48,417,059 V233G probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tspan11 T C 6: 127,938,264 Y114H probably damaging Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Usp44 G A 10: 93,850,340 C539Y probably damaging Het
Vmn2r73 G A 7: 85,869,891 P508S probably benign Het
Zfp831 A G 2: 174,646,697 D1055G possibly damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Hace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hace1 APN 10 45672357 nonsense probably null
IGL01456:Hace1 APN 10 45709998 splice site probably benign
IGL02122:Hace1 APN 10 45618604 missense probably damaging 1.00
IGL02217:Hace1 APN 10 45590375 splice site probably null
IGL02493:Hace1 APN 10 45588419 missense probably damaging 0.98
IGL02596:Hace1 APN 10 45700640 missense possibly damaging 0.55
IGL02619:Hace1 APN 10 45671434 unclassified probably benign
IGL03163:Hace1 APN 10 45672605 missense probably damaging 0.97
R0609:Hace1 UTSW 10 45648869 missense probably damaging 1.00
R0853:Hace1 UTSW 10 45648683 missense probably damaging 1.00
R2038:Hace1 UTSW 10 45700625 missense probably benign 0.03
R2212:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R2328:Hace1 UTSW 10 45648945 missense probably benign 0.43
R2881:Hace1 UTSW 10 45671134 missense probably benign 0.10
R3005:Hace1 UTSW 10 45648863 missense probably damaging 0.96
R3414:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R3930:Hace1 UTSW 10 45711508 missense probably benign 0.37
R4014:Hace1 UTSW 10 45588374 splice site probably benign
R4335:Hace1 UTSW 10 45709961 missense probably damaging 0.99
R4547:Hace1 UTSW 10 45672555 unclassified probably null
R4812:Hace1 UTSW 10 45686603 missense probably benign 0.00
R4996:Hace1 UTSW 10 45649950 missense probably benign 0.17
R5858:Hace1 UTSW 10 45711525 missense possibly damaging 0.58
R5995:Hace1 UTSW 10 45670391 missense probably benign 0.00
R6049:Hace1 UTSW 10 45686662 missense probably damaging 1.00
R6111:Hace1 UTSW 10 45589510 missense possibly damaging 0.92
R6195:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6216:Hace1 UTSW 10 45618547 missense probably benign
R6237:Hace1 UTSW 10 45648890 missense probably benign
R6467:Hace1 UTSW 10 45590266 critical splice acceptor site probably null
R6930:Hace1 UTSW 10 45618502 missense probably damaging 1.00
R7325:Hace1 UTSW 10 45589507 nonsense probably null
R7401:Hace1 UTSW 10 45670626 missense probably damaging 1.00
R7426:Hace1 UTSW 10 45605540 missense probably damaging 1.00
R7471:Hace1 UTSW 10 45700979 missense probably benign 0.06
R7533:Hace1 UTSW 10 45711474 missense probably benign 0.03
R7661:Hace1 UTSW 10 45605553 missense probably damaging 1.00
R7873:Hace1 UTSW 10 45672787 missense possibly damaging 0.92
R7956:Hace1 UTSW 10 45672787 missense possibly damaging 0.92
R7995:Hace1 UTSW 10 45589492 missense not run
R8019:Hace1 UTSW 10 45638382 missense not run
R8022:Hace1 UTSW 10 45700970 missense not run
Z1176:Hace1 UTSW 10 45686662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCACTAAACAGTTTTCTCAG -3'
(R):5'- TCACAGAGATGACGTCTTGACAG -3'

Sequencing Primer
(F):5'- CTCAGATTTTTAGCAATTTTCAGGC -3'
(R):5'- AGATGACGTCTTGACAGTCGGC -3'
Posted On2018-02-28