Incidental Mutation 'R6233:Krt40'
ID504768
Institutional Source Beutler Lab
Gene Symbol Krt40
Ensembl Gene ENSMUSG00000059169
Gene Namekeratin 40
SynonymsKa36
MMRRC Submission 044361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6233 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location99537485-99543158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99543094 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 22 (A22V)
Ref Sequence ENSEMBL: ENSMUSP00000103067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074253] [ENSMUST00000107443]
Predicted Effect probably benign
Transcript: ENSMUST00000074253
AA Change: A22V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073869
Gene: ENSMUSG00000059169
AA Change: A22V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Filament 88 399 1.07e-139 SMART
internal_repeat_1 409 419 9.76e-5 PROSPERO
internal_repeat_1 417 427 9.76e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000107443
AA Change: A22V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103067
Gene: ENSMUSG00000059169
AA Change: A22V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Filament 88 149 4.8e-19 PFAM
Pfam:Filament 146 319 6.1e-50 PFAM
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,965 T300A probably benign Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acvr1 T A 2: 58,448,399 N437I probably benign Het
Adgrg7 T A 16: 56,778,642 T57S possibly damaging Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
AI481877 T A 4: 59,076,245 D566V possibly damaging Het
Ankrd9 A T 12: 110,977,120 I160N probably damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Clmn A C 12: 104,785,455 L247R probably damaging Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dmkn C A 7: 30,779,679 A280E probably damaging Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsc3 C T 18: 19,965,795 G776R possibly damaging Het
Eefsec A G 6: 88,358,544 probably null Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eny2 A G 15: 44,433,660 probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fbxo28 A G 1: 182,341,508 S22P unknown Het
Fcrlb A G 1: 170,908,889 I106T probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm4756 T C 12: 72,619,567 Y110C probably damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Gm884 A T 11: 103,613,388 L2585I probably damaging Het
Gna12 A G 5: 140,760,692 F333L possibly damaging Het
Gria2 A G 3: 80,707,203 I510T probably damaging Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Il1rap A G 16: 26,710,506 T310A probably benign Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kcnk4 T C 19: 6,928,329 N90S probably benign Het
Lamc1 A T 1: 153,223,666 D1520E probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myh7b C T 2: 155,631,799 A1584V possibly damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr1474 T C 19: 13,471,740 Y257H probably damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Olfr799 T C 10: 129,647,296 M56T probably benign Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pilra T C 5: 137,823,501 T291A possibly damaging Het
Ppp1r9a G T 6: 5,077,610 D630Y probably damaging Het
Pros1 A C 16: 62,898,921 Q102P possibly damaging Het
Rad21l T C 2: 151,653,542 D407G probably benign Het
Rapgef5 G A 12: 117,739,718 probably null Het
Rbm25 G A 12: 83,659,426 A182T probably benign Het
Rnf13 A G 3: 57,832,970 E236G possibly damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Sdr16c6 T A 4: 4,069,984 I119F probably damaging Het
Slc12a7 T C 13: 73,805,471 S767P possibly damaging Het
Slc23a1 A G 18: 35,624,444 I258T probably damaging Het
Spata13 G A 14: 60,692,007 R338H probably benign Het
Sufu G A 19: 46,475,632 G428R probably damaging Het
Sult2a1 T C 7: 13,832,675 D125G probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tenm3 A C 8: 48,417,059 V233G probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tspan11 T C 6: 127,938,264 Y114H probably damaging Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Usp44 G A 10: 93,850,340 C539Y probably damaging Het
Vmn2r73 G A 7: 85,869,891 P508S probably benign Het
Zfp831 A G 2: 174,646,697 D1055G possibly damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Krt40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Krt40 APN 11 99541219 missense probably damaging 1.00
IGL01483:Krt40 APN 11 99542727 missense probably damaging 1.00
IGL01621:Krt40 APN 11 99542868 missense probably damaging 1.00
IGL01921:Krt40 APN 11 99543163 unclassified probably benign
IGL02095:Krt40 APN 11 99541671 missense probably damaging 0.98
IGL02735:Krt40 APN 11 99538635 missense probably damaging 1.00
IGL02960:Krt40 APN 11 99539867 splice site probably null
IGL02965:Krt40 APN 11 99541666 missense probably damaging 1.00
IGL03168:Krt40 APN 11 99543028 missense possibly damaging 0.87
IGL03240:Krt40 APN 11 99537568 missense probably damaging 1.00
IGL03387:Krt40 APN 11 99539885 missense probably damaging 1.00
R0178:Krt40 UTSW 11 99541739 missense probably damaging 0.99
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0389:Krt40 UTSW 11 99541714 nonsense probably null
R1104:Krt40 UTSW 11 99540233 missense probably damaging 1.00
R2018:Krt40 UTSW 11 99540087 missense probably damaging 1.00
R2022:Krt40 UTSW 11 99539992 missense probably damaging 1.00
R4498:Krt40 UTSW 11 99543074 missense possibly damaging 0.53
R4716:Krt40 UTSW 11 99540219 missense probably damaging 1.00
R5886:Krt40 UTSW 11 99540081 missense probably benign 0.34
R6232:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6235:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6248:Krt40 UTSW 11 99541740 missense possibly damaging 0.95
R7064:Krt40 UTSW 11 99540128 missense probably benign 0.32
R7400:Krt40 UTSW 11 99543143 missense probably benign 0.00
R7589:Krt40 UTSW 11 99540157 missense probably damaging 1.00
R7831:Krt40 UTSW 11 99541261 missense probably benign 0.06
R7838:Krt40 UTSW 11 99540135 missense possibly damaging 0.92
R7914:Krt40 UTSW 11 99541261 missense probably benign 0.06
R7921:Krt40 UTSW 11 99540135 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAACGATCCTTCCTCACAC -3'
(R):5'- TGGCACCTGTAGCACTAGAG -3'

Sequencing Primer
(F):5'- GATCCTTCCTCACACCATGCAC -3'
(R):5'- ACATCGGTGTGTCCTGTAAATACC -3'
Posted On2018-02-28