Mutagenetix > Incidental Mutation

Incidental Mutation 'R6233:Pros1'

504784

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

044361-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6233 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 62898921 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 102 (Q102P)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023629
AA Change: Q102P

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: Q102P

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155940

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	G	6: 48,930,965	T300A	probably benign	Het
9530053A07Rik	T	C	7: 28,131,460	C33R	probably damaging	Het
Acvr1	T	A	2: 58,448,399	N437I	probably benign	Het
Adgrg7	T	A	16: 56,778,642	T57S	possibly damaging	Het
Agbl2	T	A	2: 90,813,313	D792E	probably benign	Het
AI481877	T	A	4: 59,076,245	D566V	possibly damaging	Het
Ankrd9	A	T	12: 110,977,120	I160N	probably damaging	Het
Baz2b	T	A	2: 59,907,511	Q1818L	possibly damaging	Het
Bod1	A	G	11: 31,666,740	*174Q	probably null	Het
Cacna1a	A	G	8: 84,588,753	Y1539C	probably damaging	Het
Clmn	A	C	12: 104,785,455	L247R	probably damaging	Het
Cyp1b1	G	T	17: 79,714,266	L16M	probably damaging	Het
Dhx29	T	A	13: 112,964,537	S1205T	probably benign	Het
Dmkn	C	A	7: 30,779,679	A280E	probably damaging	Het
Dnah7b	G	A	1: 46,204,269	D1578N	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dsc3	C	T	18: 19,965,795	G776R	possibly damaging	Het
Eefsec	A	G	6: 88,358,544		probably null	Het
Efhb	A	G	17: 53,462,552	F243S	possibly damaging	Het
Eif2ak2	A	T	17: 78,871,233	Y137*	probably null	Het
Eny2	A	G	15: 44,433,660		probably null	Het
F2rl3	A	G	8: 72,762,885	T247A	probably benign	Het
Fan1	A	T	7: 64,354,371	H782Q	probably damaging	Het
Fbxo28	A	G	1: 182,341,508	S22P	unknown	Het
Fcrlb	A	G	1: 170,908,889	I106T	probably damaging	Het
Fer1l5	T	C	1: 36,375,286		probably null	Het
Fgfbp1	T	C	5: 43,979,362	D196G	possibly damaging	Het
Gab1	A	T	8: 80,879,532	Y24*	probably null	Het
Gcc2	T	C	10: 58,270,984	S681P	probably damaging	Het
Git2	T	C	5: 114,767,114	N94S	probably benign	Het
Gm4756	T	C	12: 72,619,567	Y110C	probably damaging	Het
Gm5346	T	G	8: 43,625,912	N425T	probably benign	Het
Gm5799	T	G	14: 43,544,631	L87V	probably damaging	Het
Gm884	A	T	11: 103,613,388	L2585I	probably damaging	Het
Gna12	A	G	5: 140,760,692	F333L	possibly damaging	Het
Gria2	A	G	3: 80,707,203	I510T	probably damaging	Het
Hace1	T	A	10: 45,670,443	I391N	possibly damaging	Het
Il1rap	A	G	16: 26,710,506	T310A	probably benign	Het
Itpr3	T	C	17: 27,086,960	I164T	probably damaging	Het
Kcnk4	T	C	19: 6,928,329	N90S	probably benign	Het
Krt40	G	A	11: 99,543,094	A22V	possibly damaging	Het
Lamc1	A	T	1: 153,223,666	D1520E	probably benign	Het
Mipep	T	A	14: 60,872,105	W644R	probably damaging	Het
Mycl	A	G	4: 122,999,920	D171G	probably damaging	Het
Myh7b	C	T	2: 155,631,799	A1584V	possibly damaging	Het
Nf1	A	G	11: 79,565,975	Y629C	probably damaging	Het
Obscn	T	A	11: 58,997,207	E2164V	probably damaging	Het
Olfr1061	T	C	2: 86,413,207	I282V	probably damaging	Het
Olfr1152	T	C	2: 87,868,560	S190P	possibly damaging	Het
Olfr1474	T	C	19: 13,471,740	Y257H	probably damaging	Het
Olfr648	A	T	7: 104,179,754	V218D	possibly damaging	Het
Olfr799	T	C	10: 129,647,296	M56T	probably benign	Het
Pcdh20	T	C	14: 88,468,052	E604G	probably benign	Het
Pilra	T	C	5: 137,823,501	T291A	possibly damaging	Het
Ppp1r9a	G	T	6: 5,077,610	D630Y	probably damaging	Het
Rad21l	T	C	2: 151,653,542	D407G	probably benign	Het
Rapgef5	G	A	12: 117,739,718		probably null	Het
Rbm25	G	A	12: 83,659,426	A182T	probably benign	Het
Rnf13	A	G	3: 57,832,970	E236G	possibly damaging	Het
Robo3	T	G	9: 37,420,929	Y891S	probably damaging	Het
Rsrp1	T	A	4: 134,926,802	I255K	probably damaging	Het
Scn1a	T	A	2: 66,277,618	Y1588F	possibly damaging	Het
Sdr16c6	T	A	4: 4,069,984	I119F	probably damaging	Het
Slc12a7	T	C	13: 73,805,471	S767P	possibly damaging	Het
Slc23a1	A	G	18: 35,624,444	I258T	probably damaging	Het
Spata13	G	A	14: 60,692,007	R338H	probably benign	Het
Sufu	G	A	19: 46,475,632	G428R	probably damaging	Het
Sult2a1	T	C	7: 13,832,675	D125G	probably damaging	Het
Tapbp	T	C	17: 33,919,982	L41P	probably damaging	Het
Tbc1d16	T	A	11: 119,210,565	K40*	probably null	Het
Tdrd6	A	G	17: 43,629,752	V135A	probably damaging	Het
Tenm3	A	C	8: 48,417,059	V233G	probably damaging	Het
Tmem87a	A	T	2: 120,392,175		probably null	Het
Tspan11	T	C	6: 127,938,264	Y114H	probably damaging	Het
Ttn	T	A	2: 76,737,653	Y27632F	probably benign	Het
Usp44	G	A	10: 93,850,340	C539Y	probably damaging	Het
Vmn2r73	G	A	7: 85,869,891	P508S	probably benign	Het
Zfp831	A	G	2: 174,646,697	D1055G	possibly damaging	Het
Zfp871	CCACAC	CC	17: 32,775,520		probably null	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGGGTGGTCTGTTAGTACTAACTC -3'
(R):5'- CCGCTCAGCTGAAATGTTTGG -3'

Sequencing Primer
(F):5'- CTAACTCTTGTGAAGCAACAGG -3'
(R):5'- CAGCTGAAATGTTTGGGGAAATTTTC -3'

Posted On

2018-02-28