Incidental Mutation 'R6234:Serpinb2'
ID504799
Institutional Source Beutler Lab
Gene Symbol Serpinb2
Ensembl Gene ENSMUSG00000062345
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 2
SynonymsPAI-2, ovalbumin, Planh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107511423-107535478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107524771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 360 (V360M)
Ref Sequence ENSEMBL: ENSMUSP00000065277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009356] [ENSMUST00000064916] [ENSMUST00000146597] [ENSMUST00000182198]
Predicted Effect probably damaging
Transcript: ENSMUST00000009356
AA Change: V360M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009356
Gene: ENSMUSG00000062345
AA Change: V360M

DomainStartEndE-ValueType
SERPIN 13 415 1.07e-188 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064916
AA Change: V360M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065277
Gene: ENSMUSG00000062345
AA Change: V360M

DomainStartEndE-ValueType
SERPIN 13 415 1.07e-188 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143832
SMART Domains Protein: ENSMUSP00000114751
Gene: ENSMUSG00000062345

DomainStartEndE-ValueType
SERPIN 1 189 2.36e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172762
Predicted Effect probably benign
Transcript: ENSMUST00000182198
SMART Domains Protein: ENSMUSP00000138771
Gene: ENSMUSG00000092572

DomainStartEndE-ValueType
SERPIN 1 320 6.18e-139 SMART
Meta Mutation Damage Score 0.6796 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to a slight to mild reduction in platelet, lymphocyte, neutrophil, and monocyte cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Serpinb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Serpinb2 APN 1 107524736 missense probably benign 0.04
IGL00870:Serpinb2 APN 1 107523070 missense probably damaging 1.00
IGL01535:Serpinb2 APN 1 107519773 critical splice donor site probably null
IGL01603:Serpinb2 APN 1 107522180 missense probably benign 0.28
IGL01721:Serpinb2 APN 1 107515603 missense probably damaging 1.00
IGL02536:Serpinb2 APN 1 107524949 unclassified probably benign
IGL03167:Serpinb2 APN 1 107522755 missense probably benign 0.04
IGL03184:Serpinb2 APN 1 107524877 missense probably damaging 1.00
R1728:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1728:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1728:Serpinb2 UTSW 1 107523890 missense probably benign
R1728:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1728:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1729:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1729:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1729:Serpinb2 UTSW 1 107523890 missense probably benign
R1729:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1729:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1730:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1730:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1730:Serpinb2 UTSW 1 107523890 missense probably benign
R1730:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1730:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1739:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1739:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1739:Serpinb2 UTSW 1 107523890 missense probably benign
R1739:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1739:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1762:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1762:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1762:Serpinb2 UTSW 1 107523890 missense probably benign
R1762:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1762:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1783:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1783:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1783:Serpinb2 UTSW 1 107523890 missense probably benign
R1783:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1783:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1785:Serpinb2 UTSW 1 107515635 missense probably damaging 0.97
R1785:Serpinb2 UTSW 1 107523834 missense probably benign 0.00
R1785:Serpinb2 UTSW 1 107523890 missense probably benign
R1785:Serpinb2 UTSW 1 107523894 missense probably benign 0.00
R1785:Serpinb2 UTSW 1 107524543 missense probably benign 0.00
R1889:Serpinb2 UTSW 1 107524607 missense probably damaging 1.00
R1895:Serpinb2 UTSW 1 107524607 missense probably damaging 1.00
R2056:Serpinb2 UTSW 1 107523813 missense probably damaging 1.00
R2061:Serpinb2 UTSW 1 107522795 missense possibly damaging 0.87
R2186:Serpinb2 UTSW 1 107523964 splice site probably null
R4925:Serpinb2 UTSW 1 107515489 missense probably benign 0.37
R5150:Serpinb2 UTSW 1 107523209 critical splice donor site probably null
R5421:Serpinb2 UTSW 1 107523851 missense probably damaging 1.00
R5899:Serpinb2 UTSW 1 107519716 missense probably damaging 0.96
R6243:Serpinb2 UTSW 1 107523139 missense probably damaging 1.00
R7088:Serpinb2 UTSW 1 107524692 missense probably damaging 1.00
R7192:Serpinb2 UTSW 1 107524576 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGATCAGCAAAGACACACTG -3'
(R):5'- ACAAAACCTCATGTGGAAATAGGTC -3'

Sequencing Primer
(F):5'- CACACTGGATGAAGATGATGTTGTG -3'
(R):5'- ATGTGGAAATAGGTCTTCCCC -3'
Posted On2018-02-28