Incidental Mutation 'R6234:Cd34'
ID504802
Institutional Source Beutler Lab
Gene Symbol Cd34
Ensembl Gene ENSMUSG00000016494
Gene NameCD34 antigen
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location194938819-194961279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 194948000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 81 (I81F)
Ref Sequence ENSEMBL: ENSMUSP00000106439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016638] [ENSMUST00000110815]
Predicted Effect probably damaging
Transcript: ENSMUST00000016638
AA Change: I81F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016638
Gene: ENSMUSG00000016494
AA Change: I81F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 156 167 N/A INTRINSIC
Pfam:CD34_antigen 187 382 2.3e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110815
AA Change: I81F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106439
Gene: ENSMUSG00000016494
AA Change: I81F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 156 167 N/A INTRINSIC
Pfam:CD34_antigen 187 325 3.5e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194036
AA Change: I71F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194458
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may play a role in the attachment of stem cells to the bone marrow extracellular matrix or to stromal cells. This single-pass membrane protein is highly glycosylated and phosphorylated by protein kinase C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null allele show decreased splenocyte number and hematopoietic defects. Homozygotes for another null allele show reduced eosinophil accumulation after allergen exposure, impaired TPA-induced hair follicle stem cell activation and reduced incidence of chemically-induced skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Cd34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Cd34 APN 1 194960114 missense probably damaging 1.00
IGL00979:Cd34 APN 1 194949508 missense possibly damaging 0.92
IGL01762:Cd34 APN 1 194939033 missense probably benign 0.07
IGL01861:Cd34 APN 1 194958580 unclassified probably benign
IGL03227:Cd34 APN 1 194958463 missense probably damaging 1.00
R0628:Cd34 UTSW 1 194959217 missense probably damaging 1.00
R2057:Cd34 UTSW 1 194959142 missense probably damaging 1.00
R2249:Cd34 UTSW 1 194947952 missense possibly damaging 0.95
R2435:Cd34 UTSW 1 194939026 missense probably damaging 0.96
R4795:Cd34 UTSW 1 194951011 missense probably damaging 0.98
R5076:Cd34 UTSW 1 194948030 intron probably benign
R5400:Cd34 UTSW 1 194938958 unclassified probably benign
R5414:Cd34 UTSW 1 194947911 missense probably benign 0.05
R5641:Cd34 UTSW 1 194947968 missense probably benign 0.25
R6110:Cd34 UTSW 1 194949569 splice site probably null
R6148:Cd34 UTSW 1 194948008 critical splice donor site probably null
R7715:Cd34 UTSW 1 194949316 missense probably damaging 0.98
R8029:Cd34 UTSW 1 194958552 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCTTGGTTTACAGATCTAAATAACT -3'
(R):5'- GTTTCCAACACAGAGAAAGCTATT -3'

Sequencing Primer
(F):5'- ATAACTTGACTTCTGCTACCACGGAG -3'
(R):5'- AGTGGATGCTCACAGTCATC -3'
Posted On2018-02-28