Mutagenetix > Incidental Mutations

Incidental Mutation 'R6234:Hc'

504804

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000026874

Gene Name

hemolytic complement

Synonyms

He, C5, C5a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.686) question?

Stock #

R6234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34983331-35061438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35028046 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 742 (I742V)

Ref Sequence

ENSEMBL: ENSMUSP00000028233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028233]

PDB Structure

Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028233
AA Change: I742V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: I742V

Domain	Start	End	E-Value	Type
Pfam:A2M_N	125	219	1.8e-15	PFAM
A2M_N_2	465	612	9.83e-34	SMART
ANATO	702	736	4.73e-12	SMART
A2M	776	863	2.44e-29	SMART
Pfam:A2M_comp	1055	1306	2.3e-68	PFAM
A2M_recep	1423	1513	7.29e-28	SMART
C345C	1553	1665	1.51e-35	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,983,471	T2475A	probably benign	Het
Adgb	A	C	10: 10,353,080		probably null	Het
Aldoart1	A	G	4: 72,852,172	I78T	probably damaging	Het
Bcl2l2	A	G	14: 54,884,788	D136G	probably benign	Het
Cd34	A	T	1: 194,948,000	I81F	probably damaging	Het
Chmp1b	T	A	18: 67,206,098	*200R	probably null	Het
Clic6	T	C	16: 92,499,222	S257P	probably benign	Het
Cnga4	T	G	7: 105,407,699	Y336*	probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Eef1akmt2	T	C	7: 132,827,856	T215A	probably damaging	Het
Fbrsl1	G	A	5: 110,378,051	T95I	probably damaging	Het
Fer1l6	T	C	15: 58,560,639	I345T	probably damaging	Het
Fmn1	T	C	2: 113,365,655	F567L	unknown	Het
Gabrg1	A	T	5: 70,842,141	L22I	probably benign	Het
Gfm1	A	G	3: 67,435,514	D127G	probably damaging	Het
Gm5114	T	A	7: 39,409,344	T284S	probably benign	Het
Gm5346	T	G	8: 43,625,912	N425T	probably benign	Het
Gm813	T	A	16: 58,614,671	D97V	probably benign	Het
Gm9925	A	T	18: 74,065,237		probably benign	Het
Heatr5a	A	T	12: 51,877,454	M1992K	possibly damaging	Het
Homer3	T	C	8: 70,291,165		probably null	Het
Hsf5	C	G	11: 87,617,294	T8S	probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Il21r	A	G	7: 125,632,585	D395G	probably damaging	Het
Kctd14	T	A	7: 97,458,012	V190E	probably damaging	Het
Mamdc4	C	G	2: 25,570,080	G57A	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Mtch1	A	T	17: 29,340,511		probably null	Het
Nasp	G	A	4: 116,622,782	A31V	possibly damaging	Het
Neil3	G	T	8: 53,608,739	D202E	probably damaging	Het
Nfkb1	C	T	3: 135,626,710	V95I	possibly damaging	Het
Ptpra	T	A	2: 130,537,588	M327K	probably damaging	Het
Ptprg	C	A	14: 12,213,747	F263L	probably damaging	Het
Sap30	A	G	8: 57,485,118	V155A	probably damaging	Het
Serpinb2	G	A	1: 107,524,771	V360M	probably damaging	Het
Stradb	A	G	1: 58,988,548	H79R	probably damaging	Het
Svep1	A	T	4: 58,113,458		probably null	Het
Tcaf2	A	T	6: 42,630,374	H215Q	probably benign	Het
Tdrd5	A	T	1: 156,293,377	S227T	possibly damaging	Het
Timmdc1	A	T	16: 38,518,499	Y76*	probably null	Het
Tmbim4	T	A	10: 120,221,723		probably null	Het
Tpr	A	G	1: 150,418,039	K854R	probably benign	Het
Trav6-5	A	G	14: 53,491,375	T30A	probably benign	Het
Trrap	T	A	5: 144,839,713		probably null	Het
Ube2o	A	T	11: 116,539,490	S1141T	probably benign	Het
Usp54	T	A	14: 20,583,450	K339I	probably damaging	Het
Vwf	T	G	6: 125,657,165	V202G	unknown	Het
Wdr7	T	C	18: 63,724,132	L93P	probably damaging	Het
Zfp871	CCACAC	CC	17: 32,775,520		probably null	Het

Other mutations in Hc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Hc	APN	2	34991629	missense	probably benign	0.00
IGL00922:Hc	APN	2	34991668	missense	probably damaging	1.00
IGL01523:Hc	APN	2	35039238	missense	probably benign	0.04
IGL01746:Hc	APN	2	35057326	missense	probably damaging	0.98
IGL01793:Hc	APN	2	35028190	missense	probably damaging	1.00
IGL01972:Hc	APN	2	34983772	missense	probably damaging	1.00
IGL02037:Hc	APN	2	35013519	missense	probably benign	0.16
IGL02048:Hc	APN	2	34996027	missense	probably benign	0.00
IGL02227:Hc	APN	2	35009911	intron	probably benign
IGL02230:Hc	APN	2	35013670	missense	probably benign
IGL02254:Hc	APN	2	34984824	missense	probably damaging	1.00
IGL02363:Hc	APN	2	35000835	missense	probably benign
IGL02650:Hc	APN	2	35000874	missense	possibly damaging	0.49
IGL03053:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03168:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03341:Hc	APN	2	35003377	missense	probably damaging	0.98
PIT4142001:Hc	UTSW	2	35031821	splice site	probably benign
PIT4378001:Hc	UTSW	2	35031864	missense	probably benign	0.13
PIT4508001:Hc	UTSW	2	34984804	missense	probably damaging	0.96
PIT4812001:Hc	UTSW	2	35029452	missense	probably benign	0.16
R0025:Hc	UTSW	2	34986292	missense	probably damaging	1.00
R0053:Hc	UTSW	2	35057275	missense	probably benign	0.32
R0197:Hc	UTSW	2	34984750	missense	probably damaging	1.00
R0218:Hc	UTSW	2	35028074	missense	probably damaging	1.00
R0242:Hc	UTSW	2	35036154	splice site	probably benign
R0496:Hc	UTSW	2	35013571	missense	probably damaging	1.00
R1205:Hc	UTSW	2	35003524	missense	possibly damaging	0.50
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1574:Hc	UTSW	2	35000765	intron	probably benign
R1610:Hc	UTSW	2	35006161	missense	probably benign	0.44
R1640:Hc	UTSW	2	35057324	nonsense	probably null
R1887:Hc	UTSW	2	35034611	missense	probably benign
R1920:Hc	UTSW	2	35029395	splice site	probably benign
R2018:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2019:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2151:Hc	UTSW	2	34991103	intron	probably benign
R2366:Hc	UTSW	2	35013636	missense	probably benign
R4093:Hc	UTSW	2	34983807	nonsense	probably null
R4288:Hc	UTSW	2	35030402	missense	probably damaging	0.98
R4501:Hc	UTSW	2	34997476	splice site	probably null
R4502:Hc	UTSW	2	35006252	missense	probably benign	0.00
R4508:Hc	UTSW	2	35013065	missense	possibly damaging	0.94
R4583:Hc	UTSW	2	35028177	missense	probably benign	0.00
R4686:Hc	UTSW	2	35039248	missense	possibly damaging	0.49
R4776:Hc	UTSW	2	35039734	missense	probably benign	0.12
R4846:Hc	UTSW	2	35019670	missense	probably benign	0.00
R5032:Hc	UTSW	2	35013532	missense	probably benign	0.07
R5089:Hc	UTSW	2	35024890	missense	probably benign	0.01
R5289:Hc	UTSW	2	34996014	critical splice donor site	probably null
R5347:Hc	UTSW	2	35037624	missense	probably benign	0.04
R5356:Hc	UTSW	2	34994995	missense	probably benign	0.00
R5379:Hc	UTSW	2	34991065	missense	probably damaging	1.00
R5403:Hc	UTSW	2	35057434	missense	probably damaging	1.00
R5418:Hc	UTSW	2	35008183	critical splice donor site	probably null
R5450:Hc	UTSW	2	35013038	missense	possibly damaging	0.67
R5494:Hc	UTSW	2	35003539	splice site	probably null
R5713:Hc	UTSW	2	35013531	missense	probably damaging	0.99
R5898:Hc	UTSW	2	34997437	missense	probably benign	0.06
R5925:Hc	UTSW	2	35030450	missense	possibly damaging	0.92
R5942:Hc	UTSW	2	35028125	nonsense	probably null
R5991:Hc	UTSW	2	35006105	missense	possibly damaging	0.91
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6115:Hc	UTSW	2	35013038	missense	probably damaging	1.00
R6264:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
R6313:Hc	UTSW	2	34989839	splice site	probably null
R6525:Hc	UTSW	2	34991224	missense	probably benign	0.06
R6577:Hc	UTSW	2	35032126	missense	probably benign	0.00
R6601:Hc	UTSW	2	35045894	missense	probably benign	0.03
R6916:Hc	UTSW	2	35010032	nonsense	probably null
R7108:Hc	UTSW	2	35039694	missense	probably benign	0.03
R7143:Hc	UTSW	2	35050438	missense	probably benign	0.00
R7388:Hc	UTSW	2	34984847	splice site	probably null
R7468:Hc	UTSW	2	35028051	missense	probably benign	0.00
R7504:Hc	UTSW	2	35061319	missense	not run
R7521:Hc	UTSW	2	35045332	missense	possibly damaging	0.80
R7582:Hc	UTSW	2	34991266	missense	possibly damaging	0.70
R7596:Hc	UTSW	2	35000847	missense	probably damaging	0.96
R7599:Hc	UTSW	2	35050419	missense	probably damaging	1.00
R7692:Hc	UTSW	2	35024149	missense	probably damaging	1.00
R7853:Hc	UTSW	2	35010033	missense	probably damaging	1.00
R7877:Hc	UTSW	2	34997399	nonsense	probably null
R8375:Hc	UTSW	2	34983719	missense	probably benign	0.32
X0066:Hc	UTSW	2	34983711	missense	probably damaging	1.00
Z1088:Hc	UTSW	2	35008249	missense	possibly damaging	0.94
Z1088:Hc	UTSW	2	35029470	missense	probably benign	0.02
Z1176:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
Z1177:Hc	UTSW	2	35013610	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGACTGGGCACTGTACCATTC -3'
(R):5'- CCATATGCTGCCACCATTTCAG -3'

Sequencing Primer
(F):5'- GGGCACTGTACCATTCCAATG -3'
(R):5'- GCTGCTAAGTACAAACATAGTGTGCC -3'

Posted On

2018-02-28