Incidental Mutation 'R6234:Ptpra'
ID504806
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Nameprotein tyrosine phosphatase, receptor type, A
SynonymsPTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130450278-130556124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130537588 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 327 (M327K)
Ref Sequence ENSEMBL: ENSMUSP00000155099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303] [ENSMUST00000230981]
Predicted Effect probably damaging
Transcript: ENSMUST00000028769
AA Change: M318K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: M318K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077303
AA Change: M354K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: M354K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230640
Predicted Effect probably damaging
Transcript: ENSMUST00000230981
AA Change: M327K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130544439 missense probably damaging 1.00
IGL01734:Ptpra APN 2 130544077 missense probably damaging 1.00
IGL02218:Ptpra APN 2 130552335 splice site probably benign
IGL02385:Ptpra APN 2 130540473 unclassified probably benign
IGL02480:Ptpra APN 2 130504261 missense probably benign 0.09
IGL03181:Ptpra APN 2 130517787 missense probably damaging 0.99
R0374:Ptpra UTSW 2 130537621 missense probably damaging 1.00
R0483:Ptpra UTSW 2 130539685 missense probably damaging 1.00
R0848:Ptpra UTSW 2 130518991 missense probably damaging 1.00
R1550:Ptpra UTSW 2 130541393 missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130544952 missense probably damaging 1.00
R1689:Ptpra UTSW 2 130503492 missense probably benign 0.01
R1760:Ptpra UTSW 2 130549827 missense probably damaging 1.00
R1943:Ptpra UTSW 2 130544104 missense probably damaging 1.00
R2114:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2115:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2117:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2187:Ptpra UTSW 2 130504299 missense probably benign
R2848:Ptpra UTSW 2 130544999 missense probably benign 0.06
R2849:Ptpra UTSW 2 130544999 missense probably benign 0.06
R4644:Ptpra UTSW 2 130544158 missense probably damaging 1.00
R4779:Ptpra UTSW 2 130537617 missense probably damaging 1.00
R4849:Ptpra UTSW 2 130532161 missense probably damaging 1.00
R4899:Ptpra UTSW 2 130544436 missense probably damaging 1.00
R5657:Ptpra UTSW 2 130504284 missense probably benign 0.06
R6018:Ptpra UTSW 2 130503502 missense probably benign
R6350:Ptpra UTSW 2 130540592 missense probably damaging 1.00
R6856:Ptpra UTSW 2 130519381 missense probably damaging 1.00
R7072:Ptpra UTSW 2 130553430 missense probably damaging 1.00
R7146:Ptpra UTSW 2 130537651 critical splice donor site probably null
R7220:Ptpra UTSW 2 130544497 missense probably damaging 1.00
R7346:Ptpra UTSW 2 130553400 missense probably damaging 1.00
R7819:Ptpra UTSW 2 130504206 missense probably benign
R8044:Ptpra UTSW 2 130544961 missense possibly damaging 0.93
R8231:Ptpra UTSW 2 130537603 missense probably damaging 1.00
R8404:Ptpra UTSW 2 130549759 missense probably damaging 1.00
R8422:Ptpra UTSW 2 130532171 missense possibly damaging 0.86
R8502:Ptpra UTSW 2 130549759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATGGTCGATACATGGG -3'
(R):5'- TGCCTGGACAATCTACTAGTGG -3'

Sequencing Primer
(F):5'- CATGGGAAACATTCACTTGTCAGGTG -3'
(R):5'- CCTGGACAATCTACTAGTGGAGTAAC -3'
Posted On2018-02-28