Incidental Mutation 'R6234:Gfm1'
ID504808
Institutional Source Beutler Lab
Gene Symbol Gfm1
Ensembl Gene ENSMUSG00000027774
Gene NameG elongation factor, mitochondrial 1
SynonymsD3Wsu133e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location67430096-67476529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67435514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 127 (D127G)
Ref Sequence ENSEMBL: ENSMUSP00000076503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077271]
Predicted Effect probably damaging
Transcript: ENSMUST00000077271
AA Change: D127G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: D127G

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161009
SMART Domains Protein: ENSMUSP00000125161
Gene: ENSMUSG00000027774

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.4e-63 PFAM
Pfam:GTP_EFTU_D2 366 432 4.1e-18 PFAM
Pfam:EFG_II 446 520 4.4e-33 PFAM
Meta Mutation Damage Score 0.9725 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Gfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gfm1 APN 3 67438560 missense possibly damaging 0.79
IGL01377:Gfm1 APN 3 67474753 missense probably damaging 1.00
IGL01397:Gfm1 APN 3 67443658 missense probably benign 0.09
IGL01738:Gfm1 APN 3 67456661 missense probably benign 0.15
IGL02679:Gfm1 APN 3 67474767 missense possibly damaging 0.56
IGL03271:Gfm1 APN 3 67474743 missense probably damaging 1.00
R0389:Gfm1 UTSW 3 67457918 missense probably benign 0.00
R0815:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R0863:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R1626:Gfm1 UTSW 3 67438644 missense probably damaging 1.00
R1843:Gfm1 UTSW 3 67435610 missense probably damaging 1.00
R1931:Gfm1 UTSW 3 67456585 missense probably benign 0.44
R2097:Gfm1 UTSW 3 67449746 missense probably damaging 0.97
R2149:Gfm1 UTSW 3 67474560 missense probably damaging 1.00
R2337:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R3739:Gfm1 UTSW 3 67456700 missense probably damaging 1.00
R4193:Gfm1 UTSW 3 67431720 missense probably damaging 1.00
R4661:Gfm1 UTSW 3 67433398 missense probably damaging 1.00
R5023:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5057:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5503:Gfm1 UTSW 3 67453727 critical splice donor site probably null
R5692:Gfm1 UTSW 3 67435622 missense probably damaging 1.00
R5771:Gfm1 UTSW 3 67435562 missense probably benign 0.11
R6232:Gfm1 UTSW 3 67467882 missense possibly damaging 0.52
R6514:Gfm1 UTSW 3 67473546 missense probably benign
R6911:Gfm1 UTSW 3 67451303 missense possibly damaging 0.83
R7295:Gfm1 UTSW 3 67440181 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGGGTTGACAGGGGATCAA -3'
(R):5'- GTTAGAGCCCATTCGGTCC -3'

Sequencing Primer
(F):5'- TAAGAGACTGTGCTGAGCTCATCAC -3'
(R):5'- AGAGCCCATTCGGTCCAGTTTG -3'
Posted On2018-02-28