Mutagenetix > Incidental Mutations

Incidental Mutation 'R6234:Gfm1'

504808

Institutional Source

Beutler Lab

Gene Symbol

Gfm1

Ensembl Gene

ENSMUSG00000027774

Gene Name

G elongation factor, mitochondrial 1

Synonyms

D3Wsu133e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67430096-67476529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67435514 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 127 (D127G)

Ref Sequence

ENSEMBL: ENSMUSP00000076503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077271]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077271
AA Change: D127G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: D127G

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	45	320	3.5e-65	PFAM
Pfam:GTP_EFTU_D2	366	432	6e-18	PFAM
Pfam:EFG_II	446	520	1.9e-31	PFAM
EFG_IV	522	642	1.64e-47	SMART
EFG_C	644	731	2.16e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161009

SMART Domains

Protein: ENSMUSP00000125161
Gene: ENSMUSG00000027774

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	45	320	3.4e-63	PFAM
Pfam:GTP_EFTU_D2	366	432	4.1e-18	PFAM
Pfam:EFG_II	446	520	4.4e-33	PFAM

Meta Mutation Damage Score

0.9725

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,983,471	T2475A	probably benign	Het
Adgb	A	C	10: 10,353,080		probably null	Het
Aldoart1	A	G	4: 72,852,172	I78T	probably damaging	Het
Bcl2l2	A	G	14: 54,884,788	D136G	probably benign	Het
Cd34	A	T	1: 194,948,000	I81F	probably damaging	Het
Chmp1b	T	A	18: 67,206,098	*200R	probably null	Het
Clic6	T	C	16: 92,499,222	S257P	probably benign	Het
Cnga4	T	G	7: 105,407,699	Y336*	probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Eef1akmt2	T	C	7: 132,827,856	T215A	probably damaging	Het
Fbrsl1	G	A	5: 110,378,051	T95I	probably damaging	Het
Fer1l6	T	C	15: 58,560,639	I345T	probably damaging	Het
Fmn1	T	C	2: 113,365,655	F567L	unknown	Het
Gabrg1	A	T	5: 70,842,141	L22I	probably benign	Het
Gm5114	T	A	7: 39,409,344	T284S	probably benign	Het
Gm5346	T	G	8: 43,625,912	N425T	probably benign	Het
Gm813	T	A	16: 58,614,671	D97V	probably benign	Het
Gm9925	A	T	18: 74,065,237		probably benign	Het
Hc	T	C	2: 35,028,046	I742V	probably benign	Het
Heatr5a	A	T	12: 51,877,454	M1992K	possibly damaging	Het
Homer3	T	C	8: 70,291,165		probably null	Het
Hsf5	C	G	11: 87,617,294	T8S	probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Il21r	A	G	7: 125,632,585	D395G	probably damaging	Het
Kctd14	T	A	7: 97,458,012	V190E	probably damaging	Het
Mamdc4	C	G	2: 25,570,080	G57A	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Mtch1	A	T	17: 29,340,511		probably null	Het
Nasp	G	A	4: 116,622,782	A31V	possibly damaging	Het
Neil3	G	T	8: 53,608,739	D202E	probably damaging	Het
Nfkb1	C	T	3: 135,626,710	V95I	possibly damaging	Het
Ptpra	T	A	2: 130,537,588	M327K	probably damaging	Het
Ptprg	C	A	14: 12,213,747	F263L	probably damaging	Het
Sap30	A	G	8: 57,485,118	V155A	probably damaging	Het
Serpinb2	G	A	1: 107,524,771	V360M	probably damaging	Het
Stradb	A	G	1: 58,988,548	H79R	probably damaging	Het
Svep1	A	T	4: 58,113,458		probably null	Het
Tcaf2	A	T	6: 42,630,374	H215Q	probably benign	Het
Tdrd5	A	T	1: 156,293,377	S227T	possibly damaging	Het
Timmdc1	A	T	16: 38,518,499	Y76*	probably null	Het
Tmbim4	T	A	10: 120,221,723		probably null	Het
Tpr	A	G	1: 150,418,039	K854R	probably benign	Het
Trav6-5	A	G	14: 53,491,375	T30A	probably benign	Het
Trrap	T	A	5: 144,839,713		probably null	Het
Ube2o	A	T	11: 116,539,490	S1141T	probably benign	Het
Usp54	T	A	14: 20,583,450	K339I	probably damaging	Het
Vwf	T	G	6: 125,657,165	V202G	unknown	Het
Wdr7	T	C	18: 63,724,132	L93P	probably damaging	Het
Zfp871	CCACAC	CC	17: 32,775,520		probably null	Het

Other mutations in Gfm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Gfm1	APN	3	67438560	missense	possibly damaging	0.79
IGL01377:Gfm1	APN	3	67474753	missense	probably damaging	1.00
IGL01397:Gfm1	APN	3	67443658	missense	probably benign	0.09
IGL01738:Gfm1	APN	3	67456661	missense	probably benign	0.15
IGL02679:Gfm1	APN	3	67474767	missense	possibly damaging	0.56
IGL03271:Gfm1	APN	3	67474743	missense	probably damaging	1.00
R0389:Gfm1	UTSW	3	67457918	missense	probably benign	0.00
R0815:Gfm1	UTSW	3	67474595	missense	probably damaging	1.00
R0863:Gfm1	UTSW	3	67474595	missense	probably damaging	1.00
R1626:Gfm1	UTSW	3	67438644	missense	probably damaging	1.00
R1843:Gfm1	UTSW	3	67435610	missense	probably damaging	1.00
R1931:Gfm1	UTSW	3	67456585	missense	probably benign	0.44
R2097:Gfm1	UTSW	3	67449746	missense	probably damaging	0.97
R2149:Gfm1	UTSW	3	67474560	missense	probably damaging	1.00
R2337:Gfm1	UTSW	3	67435514	missense	probably damaging	1.00
R3739:Gfm1	UTSW	3	67456700	missense	probably damaging	1.00
R4193:Gfm1	UTSW	3	67431720	missense	probably damaging	1.00
R4661:Gfm1	UTSW	3	67433398	missense	probably damaging	1.00
R5023:Gfm1	UTSW	3	67473544	missense	probably damaging	1.00
R5057:Gfm1	UTSW	3	67473544	missense	probably damaging	1.00
R5503:Gfm1	UTSW	3	67453727	critical splice donor site	probably null
R5692:Gfm1	UTSW	3	67435622	missense	probably damaging	1.00
R5771:Gfm1	UTSW	3	67435562	missense	probably benign	0.11
R6232:Gfm1	UTSW	3	67467882	missense	possibly damaging	0.52
R6514:Gfm1	UTSW	3	67473546	missense	probably benign
R6911:Gfm1	UTSW	3	67451303	missense	possibly damaging	0.83
R7295:Gfm1	UTSW	3	67440181	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TGGGTTGACAGGGGATCAA -3'
(R):5'- GTTAGAGCCCATTCGGTCC -3'

Sequencing Primer
(F):5'- TAAGAGACTGTGCTGAGCTCATCAC -3'
(R):5'- AGAGCCCATTCGGTCCAGTTTG -3'

Posted On

2018-02-28