Incidental Mutation 'R6234:Gabrg1'
ID504813
Institutional Source Beutler Lab
Gene Symbol Gabrg1
Ensembl Gene ENSMUSG00000001260
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 1
SynonymsGabaA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location70751047-70842617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70842141 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 22 (L22I)
Ref Sequence ENSEMBL: ENSMUSP00000142454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031119] [ENSMUST00000199705]
Predicted Effect probably benign
Transcript: ENSMUST00000031119
AA Change: L27I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031119
Gene: ENSMUSG00000001260
AA Change: L27I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 40 46 N/A INTRINSIC
Pfam:Neur_chan_LBD 64 270 7e-51 PFAM
Pfam:Neur_chan_memb 277 378 2.3e-36 PFAM
low complexity region 411 422 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197068
Predicted Effect probably benign
Transcript: ENSMUST00000199705
AA Change: L22I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142454
Gene: ENSMUSG00000001260
AA Change: L22I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 35 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 265 1.7e-50 PFAM
Pfam:Neur_chan_memb 272 304 9.5e-12 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 395 417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200126
Meta Mutation Damage Score 0.2467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Gabrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Gabrg1 APN 5 70815955 critical splice donor site probably null
IGL00798:Gabrg1 APN 5 70782283 missense probably damaging 1.00
IGL01012:Gabrg1 APN 5 70778169 missense probably benign 0.03
IGL01597:Gabrg1 APN 5 70782348 missense probably damaging 1.00
IGL01637:Gabrg1 APN 5 70777205 missense probably damaging 1.00
IGL02589:Gabrg1 APN 5 70842152 nonsense probably null
IGL03031:Gabrg1 APN 5 70794682 nonsense probably null
IGL03346:Gabrg1 APN 5 70778131 missense possibly damaging 0.89
PIT4260001:Gabrg1 UTSW 5 70782280 missense probably benign 0.01
R0197:Gabrg1 UTSW 5 70774389 missense probably damaging 1.00
R1271:Gabrg1 UTSW 5 70777144 missense probably damaging 0.98
R1795:Gabrg1 UTSW 5 70782253 missense possibly damaging 0.83
R1817:Gabrg1 UTSW 5 70754251 missense probably benign 0.08
R1820:Gabrg1 UTSW 5 70774413 missense probably damaging 1.00
R2254:Gabrg1 UTSW 5 70782364 nonsense probably null
R4566:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R4768:Gabrg1 UTSW 5 70754173 missense probably damaging 0.99
R4976:Gabrg1 UTSW 5 70774411 missense possibly damaging 0.95
R5104:Gabrg1 UTSW 5 70774432 missense probably damaging 1.00
R6062:Gabrg1 UTSW 5 70780713 missense probably damaging 1.00
R6086:Gabrg1 UTSW 5 70754053 missense probably damaging 1.00
R6148:Gabrg1 UTSW 5 70774461 missense probably damaging 1.00
R6724:Gabrg1 UTSW 5 70754209 missense possibly damaging 0.80
R6786:Gabrg1 UTSW 5 70754267 missense probably benign 0.00
R6794:Gabrg1 UTSW 5 70815971 missense probably damaging 1.00
R7209:Gabrg1 UTSW 5 70754170 missense probably damaging 0.98
R7654:Gabrg1 UTSW 5 70778161 missense probably benign 0.44
R7671:Gabrg1 UTSW 5 70815980 missense probably damaging 1.00
R7844:Gabrg1 UTSW 5 70774332 missense probably damaging 1.00
R7877:Gabrg1 UTSW 5 70816072 missense probably damaging 0.99
R8219:Gabrg1 UTSW 5 70774300 nonsense probably null
X0027:Gabrg1 UTSW 5 70754261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGCCGTCTCCAAGTAAGC -3'
(R):5'- TCCGTAGCTCAGTTCTGCTG -3'

Sequencing Primer
(F):5'- TGCCGTCTCCAAGTAAGCAGAATC -3'
(R):5'- GAGGTGTACTGCCTATCCAC -3'
Posted On2018-02-28