Incidental Mutation 'R6234:Cnga4'
ID504819
Institutional Source Beutler Lab
Gene Symbol Cnga4
Ensembl Gene ENSMUSG00000030897
Gene Namecyclic nucleotide gated channel alpha 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105404568-105408742 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 105407699 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 336 (Y336*)
Ref Sequence ENSEMBL: ENSMUSP00000147387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033187] [ENSMUST00000210344]
Predicted Effect probably null
Transcript: ENSMUST00000033187
AA Change: Y439*
SMART Domains Protein: ENSMUSP00000033187
Gene: ENSMUSG00000030897
AA Change: Y439*

DomainStartEndE-ValueType
Pfam:Ion_trans 34 276 1.1e-28 PFAM
cNMP 348 472 1.54e-25 SMART
low complexity region 500 508 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210344
AA Change: Y336*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNGA4 is a modulatory subunit of vertebrate cyclic nucleotide-gated membrane channels that transduce odorant signals (Munger et al., 2001 [PubMed 11739959]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Inactivation of this gene results in odor adaptation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Cnga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cnga4 APN 7 105404962 missense probably benign
IGL01418:Cnga4 APN 7 105404962 missense probably benign
IGL02450:Cnga4 APN 7 105405748 missense probably damaging 1.00
IGL02533:Cnga4 APN 7 105407961 missense probably damaging 0.97
BB001:Cnga4 UTSW 7 105407821 missense probably benign 0.00
BB011:Cnga4 UTSW 7 105407821 missense probably benign 0.00
IGL03052:Cnga4 UTSW 7 105404725 missense probably benign 0.21
R0020:Cnga4 UTSW 7 105405677 missense probably damaging 1.00
R0135:Cnga4 UTSW 7 105406848 missense probably damaging 1.00
R0281:Cnga4 UTSW 7 105407668 missense probably damaging 1.00
R0506:Cnga4 UTSW 7 105407740 missense probably damaging 1.00
R0599:Cnga4 UTSW 7 105405818 missense probably damaging 1.00
R0646:Cnga4 UTSW 7 105404975 missense possibly damaging 0.47
R0980:Cnga4 UTSW 7 105408006 missense probably damaging 1.00
R1727:Cnga4 UTSW 7 105405754 missense probably damaging 1.00
R3415:Cnga4 UTSW 7 105407118 missense probably damaging 1.00
R3768:Cnga4 UTSW 7 105407680 missense probably damaging 1.00
R4559:Cnga4 UTSW 7 105405685 missense probably damaging 1.00
R4852:Cnga4 UTSW 7 105405730 missense probably benign 0.01
R5081:Cnga4 UTSW 7 105407025 missense probably benign 0.20
R6232:Cnga4 UTSW 7 105407699 nonsense probably null
R6235:Cnga4 UTSW 7 105407699 nonsense probably null
R6824:Cnga4 UTSW 7 105406829 missense probably benign
R6866:Cnga4 UTSW 7 105407745 missense possibly damaging 0.95
R6997:Cnga4 UTSW 7 105406983 missense probably damaging 1.00
R7019:Cnga4 UTSW 7 105405829 missense probably benign 0.00
R7273:Cnga4 UTSW 7 105406965 missense probably damaging 1.00
R7509:Cnga4 UTSW 7 105406890 missense probably benign 0.32
R7522:Cnga4 UTSW 7 105405988 missense probably damaging 0.99
R7545:Cnga4 UTSW 7 105407079 missense probably damaging 1.00
R7873:Cnga4 UTSW 7 105407042 missense probably damaging 0.99
R7924:Cnga4 UTSW 7 105407821 missense probably benign 0.00
R7969:Cnga4 UTSW 7 105406046 missense probably damaging 1.00
R8024:Cnga4 UTSW 7 105406835 missense probably damaging 1.00
R8284:Cnga4 UTSW 7 105408032 missense probably benign 0.17
X0025:Cnga4 UTSW 7 105405220 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAAAGTGGCTTGGCTCAG -3'
(R):5'- CAAACTTGGTCTGTAGGTCATCAAG -3'

Sequencing Primer
(F):5'- GAAGCACCAATGTGGAGGTTACATC -3'
(R):5'- AGGTCATCAAGCTGCTGGTC -3'
Posted On2018-02-28