Incidental Mutation 'R6234:Neil3'
ID504822
Institutional Source Beutler Lab
Gene Symbol Neil3
Ensembl Gene ENSMUSG00000039396
Gene Namenei like 3 (E. coli)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location53586867-53639065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53608739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 202 (D202E)
Ref Sequence ENSEMBL: ENSMUSP00000041909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047768] [ENSMUST00000135443]
PDB Structure
Crystal structure of mouse Endonuclease VIII-LIKE 3 (mNEIL3) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000047768
AA Change: D202E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041909
Gene: ENSMUSG00000039396
AA Change: D202E

DomainStartEndE-ValueType
low complexity region 43 54 N/A INTRINSIC
Blast:Fapy_DNA_glyco 57 137 5e-34 BLAST
H2TH 152 235 6.13e-6 SMART
ZnF_RBZ 320 344 2.28e-5 SMART
Pfam:zf-GRF 506 551 1.2e-24 PFAM
Pfam:zf-GRF 553 597 5.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126157
SMART Domains Protein: ENSMUSP00000115066
Gene: ENSMUSG00000039396

DomainStartEndE-ValueType
Blast:Fapy_DNA_glyco 44 86 1e-12 BLAST
H2TH 101 184 6.13e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130656
Predicted Effect probably benign
Transcript: ENSMUST00000135443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153267
SMART Domains Protein: ENSMUSP00000122287
Gene: ENSMUSG00000039396

DomainStartEndE-ValueType
Blast:Fapy_DNA_glyco 11 53 5e-13 BLAST
H2TH 68 151 6.13e-6 SMART
Meta Mutation Damage Score 0.2868 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEIL3 belongs to a class of DNA glycosylases homologous to the bacterial Fpg/Nei family. These glycosylases initiate the first step in base excision repair by cleaving bases damaged by reactive oxygen species and introducing a DNA strand break via the associated lyase reaction (Bandaru et al., 2002 [PubMed 12509226]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased neurogenesis following hypoxia-ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Neil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0426:Neil3 UTSW 8 53609396 unclassified probably benign
R0533:Neil3 UTSW 8 53638775 splice site probably null
R0943:Neil3 UTSW 8 53609369 unclassified probably benign
R1688:Neil3 UTSW 8 53601034 missense probably damaging 1.00
R1875:Neil3 UTSW 8 53599419 missense probably damaging 1.00
R2238:Neil3 UTSW 8 53599276 missense possibly damaging 0.68
R3979:Neil3 UTSW 8 53623664 missense probably damaging 1.00
R4909:Neil3 UTSW 8 53638893 missense probably damaging 1.00
R5069:Neil3 UTSW 8 53601041 missense possibly damaging 0.89
R5407:Neil3 UTSW 8 53601019 missense probably benign 0.00
R6144:Neil3 UTSW 8 53599412 missense probably benign 0.01
R6185:Neil3 UTSW 8 53599147 missense probably benign 0.03
R6375:Neil3 UTSW 8 53587276 missense possibly damaging 0.71
R6830:Neil3 UTSW 8 53599479 missense probably benign 0.00
R7003:Neil3 UTSW 8 53600966 missense possibly damaging 0.60
R8165:Neil3 UTSW 8 53589094 missense probably benign 0.00
R8390:Neil3 UTSW 8 53609524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAAGTCTCCCCAGTTG -3'
(R):5'- CTATAGAAATTCGGTGGAAAGCC -3'

Sequencing Primer
(F):5'- AAGTCTCCCCAGTTGGAATG -3'
(R):5'- CCAACAGAGAGTCAGAGTGATG -3'
Posted On2018-02-28