Incidental Mutation 'R6234:Sap30'
ID504823
Institutional Source Beutler Lab
Gene Symbol Sap30
Ensembl Gene ENSMUSG00000031609
Gene Namesin3 associated polypeptide
Synonyms30kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location57482707-57487860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57485118 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 155 (V155A)
Ref Sequence ENSEMBL: ENSMUSP00000034022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034022]
PDB Structure
Solution structure of the mSin3A PAH3-SAP30 SID complex [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034022
AA Change: V155A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034022
Gene: ENSMUSG00000031609
AA Change: V155A

DomainStartEndE-ValueType
Pfam:zf-SAP30 63 133 3e-39 PFAM
Pfam:SAP30_Sin3_bdg 153 205 1.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180690
Meta Mutation Damage Score 0.2752 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histone acetylation plays a key role in the regulation of eukaryotic gene expression. Histone acetylation and deacetylation are catalyzed by multisubunit complexes. The protein encoded by this gene is a component of the histone deacetylase complex, which includes SIN3, SAP18, HDAC1, HDAC2, RbAp46, RbAp48, and other polypeptides. This complex is active in deacetylating core histone octamers, but inactive in deacetylating nucleosomal histones. A pseudogene of this gene is located on chromosome 3. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Sap30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Sap30 APN 8 57485089 missense possibly damaging 0.95
IGL03294:Sap30 APN 8 57487301 missense probably damaging 0.98
E0374:Sap30 UTSW 8 57485061 missense probably damaging 1.00
R0125:Sap30 UTSW 8 57485511 missense probably null 0.99
R0570:Sap30 UTSW 8 57482966 missense possibly damaging 0.95
R1905:Sap30 UTSW 8 57487311 missense probably damaging 0.99
R2056:Sap30 UTSW 8 57487248 splice site probably null
R2201:Sap30 UTSW 8 57485472 splice site probably null
R7428:Sap30 UTSW 8 57487512 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGCTTTCCTAGGTGGCAG -3'
(R):5'- CCGGAAGTTTACAATATGTATCCC -3'

Sequencing Primer
(F):5'- GGTGGCAGATAGATGTTTCTAAAC -3'
(R):5'- GTACAGGTCTGAGTGTGTAAAT -3'
Posted On2018-02-28