Incidental Mutation 'R6234:Adgb'
ID504825
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 10353080 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172530
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179956
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208717
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
R7128:Adgb UTSW 10 10472241 missense probably benign 0.26
R7326:Adgb UTSW 10 10400574 missense possibly damaging 0.80
R7386:Adgb UTSW 10 10377949 missense possibly damaging 0.52
R7431:Adgb UTSW 10 10391955 splice site probably null
R7569:Adgb UTSW 10 10431252 missense probably benign
R7579:Adgb UTSW 10 10410818 nonsense probably null
R7582:Adgb UTSW 10 10390821 missense probably damaging 1.00
R7615:Adgb UTSW 10 10436010 missense probably damaging 0.96
R7692:Adgb UTSW 10 10411712 critical splice donor site probably null
R7774:Adgb UTSW 10 10339660 nonsense probably null
R7808:Adgb UTSW 10 10378659 splice site probably null
R8158:Adgb UTSW 10 10378734 missense probably benign 0.22
R8386:Adgb UTSW 10 10350304 missense probably damaging 1.00
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10378742 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGAGCTTGCTTTTCCTTAGC -3'
(R):5'- GGCAAGCATGGTGTTAGTGATC -3'

Sequencing Primer
(F):5'- AGCTAACTTTTCTTTCTCGGCAG -3'
(R):5'- TTAGTGATCTGATGGTTGCATAAC -3'
Posted On2018-02-28