Incidental Mutation 'R6234:Ube2o'
ID504827
Institutional Source Beutler Lab
Gene Symbol Ube2o
Ensembl Gene ENSMUSG00000020802
Gene Nameubiquitin-conjugating enzyme E2O
SynonymsB230113M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116537740-116581447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116539490 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1141 (S1141T)
Ref Sequence ENSEMBL: ENSMUSP00000080791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063396] [ENSMUST00000063446] [ENSMUST00000082152] [ENSMUST00000100201] [ENSMUST00000106386] [ENSMUST00000106387] [ENSMUST00000106388] [ENSMUST00000124682] [ENSMUST00000138840] [ENSMUST00000141798] [ENSMUST00000145737] [ENSMUST00000154034] [ENSMUST00000155102]
Predicted Effect probably benign
Transcript: ENSMUST00000063396
SMART Domains Protein: ENSMUSP00000064743
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063446
SMART Domains Protein: ENSMUSP00000067865
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082152
AA Change: S1141T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802
AA Change: S1141T

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100201
SMART Domains Protein: ENSMUSP00000097775
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
low complexity region 256 262 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106386
SMART Domains Protein: ENSMUSP00000101994
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106387
SMART Domains Protein: ENSMUSP00000101995
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106388
SMART Domains Protein: ENSMUSP00000101996
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124682
SMART Domains Protein: ENSMUSP00000116055
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136526
Predicted Effect probably benign
Transcript: ENSMUST00000138840
SMART Domains Protein: ENSMUSP00000121064
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141798
SMART Domains Protein: ENSMUSP00000131010
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DAGKc 22 159 1.19e-8 SMART
low complexity region 263 269 N/A INTRINSIC
low complexity region 374 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145737
SMART Domains Protein: ENSMUSP00000114622
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154034
SMART Domains Protein: ENSMUSP00000121219
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155102
SMART Domains Protein: ENSMUSP00000114819
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
Pfam:DAGK_cat 16 116 4.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150658
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased MEF proliferation and transformation and increased pre-weaning lethality. Mice heterozygous for the allele exhibit increased total body fat amount, increased startle reflex, increased grip strength and increased circulating HDL cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Ube2o
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ube2o APN 11 116544754 missense probably benign
IGL00973:Ube2o APN 11 116541205 missense probably damaging 1.00
IGL01291:Ube2o APN 11 116540134 missense probably damaging 1.00
IGL01804:Ube2o APN 11 116544373 missense probably benign 0.03
IGL02138:Ube2o APN 11 116543400 splice site probably benign
IGL02317:Ube2o APN 11 116541563 missense probably damaging 1.00
IGL02515:Ube2o APN 11 116543699 missense probably damaging 1.00
IGL02535:Ube2o APN 11 116541765 missense probably benign 0.00
IGL03062:Ube2o APN 11 116541642 missense probably damaging 0.99
IGL03145:Ube2o APN 11 116544009 missense probably damaging 1.00
IGL03190:Ube2o APN 11 116545128 missense probably damaging 1.00
Delay UTSW 11 116540072 missense probably damaging 1.00
Tarry UTSW 11 116541368 missense probably damaging 1.00
ANU05:Ube2o UTSW 11 116540134 missense probably damaging 1.00
R0519:Ube2o UTSW 11 116546459 critical splice donor site probably null
R0666:Ube2o UTSW 11 116542835 missense probably damaging 1.00
R1056:Ube2o UTSW 11 116546464 missense probably damaging 1.00
R1202:Ube2o UTSW 11 116541582 missense probably damaging 1.00
R1424:Ube2o UTSW 11 116543732 missense probably benign
R1469:Ube2o UTSW 11 116545824 splice site probably benign
R1720:Ube2o UTSW 11 116544607 missense probably benign
R1791:Ube2o UTSW 11 116541494 missense probably benign 0.01
R1893:Ube2o UTSW 11 116548835 missense possibly damaging 0.68
R1997:Ube2o UTSW 11 116545337 missense probably damaging 0.99
R2156:Ube2o UTSW 11 116581146 missense probably damaging 0.98
R2199:Ube2o UTSW 11 116544745 missense probably benign
R2414:Ube2o UTSW 11 116548857 missense probably benign 0.02
R3766:Ube2o UTSW 11 116546863 splice site probably benign
R4749:Ube2o UTSW 11 116541908 missense probably benign 0.11
R5213:Ube2o UTSW 11 116541459 missense possibly damaging 0.82
R5403:Ube2o UTSW 11 116548807 missense possibly damaging 0.48
R5441:Ube2o UTSW 11 116544442 missense probably damaging 1.00
R5727:Ube2o UTSW 11 116539670 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116541378 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116544750 missense possibly damaging 0.50
R6278:Ube2o UTSW 11 116539543 missense probably damaging 1.00
R6324:Ube2o UTSW 11 116539359 missense probably benign 0.00
R6346:Ube2o UTSW 11 116541368 missense probably damaging 1.00
R6389:Ube2o UTSW 11 116548858 missense probably null 0.72
R7040:Ube2o UTSW 11 116541860 missense probably benign 0.08
R7072:Ube2o UTSW 11 116541501 missense probably benign 0.13
R7270:Ube2o UTSW 11 116543935 missense possibly damaging 0.62
R7420:Ube2o UTSW 11 116540072 missense probably damaging 1.00
R7593:Ube2o UTSW 11 116581079 missense possibly damaging 0.73
R7818:Ube2o UTSW 11 116543910 missense probably damaging 1.00
R7916:Ube2o UTSW 11 116581058 missense probably benign
R8212:Ube2o UTSW 11 116548798 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTCTTTGGTCTAACGCTGGGAG -3'
(R):5'- AGCTGGCTTTGACAGTGACC -3'

Sequencing Primer
(F):5'- ATGCATCAGGGGCTGTCTCAG -3'
(R):5'- TTTGACAGTGACCGGGGC -3'
Posted On2018-02-28