Mutagenetix > Incidental Mutations

Incidental Mutation 'R6234:Heatr5a'

504828

Institutional Source

Beutler Lab

Gene Symbol

Heatr5a

Ensembl Gene

ENSMUSG00000035181

Gene Name

HEAT repeat containing 5A

Synonyms

D930036F22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R6234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

51875871-51971321 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51877454 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1992 (M1992K)

Ref Sequence

ENSEMBL: ENSMUSP00000043115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040583]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040583
AA Change: M1992K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: M1992K

Domain	Start	End	E-Value	Type
low complexity region	56	67	N/A	INTRINSIC
SCOP:d1qbkb_	112	658	6e-13	SMART
low complexity region	1063	1078	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1110	1120	N/A	INTRINSIC
low complexity region	1122	1135	N/A	INTRINSIC
low complexity region	1496	1507	N/A	INTRINSIC
low complexity region	1722	1735	N/A	INTRINSIC
low complexity region	1925	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220369

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,983,471	T2475A	probably benign	Het
Adgb	A	C	10: 10,353,080		probably null	Het
Aldoart1	A	G	4: 72,852,172	I78T	probably damaging	Het
Bcl2l2	A	G	14: 54,884,788	D136G	probably benign	Het
Cd34	A	T	1: 194,948,000	I81F	probably damaging	Het
Chmp1b	T	A	18: 67,206,098	*200R	probably null	Het
Clic6	T	C	16: 92,499,222	S257P	probably benign	Het
Cnga4	T	G	7: 105,407,699	Y336*	probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Eef1akmt2	T	C	7: 132,827,856	T215A	probably damaging	Het
Fbrsl1	G	A	5: 110,378,051	T95I	probably damaging	Het
Fer1l6	T	C	15: 58,560,639	I345T	probably damaging	Het
Fmn1	T	C	2: 113,365,655	F567L	unknown	Het
Gabrg1	A	T	5: 70,842,141	L22I	probably benign	Het
Gfm1	A	G	3: 67,435,514	D127G	probably damaging	Het
Gm5114	T	A	7: 39,409,344	T284S	probably benign	Het
Gm5346	T	G	8: 43,625,912	N425T	probably benign	Het
Gm813	T	A	16: 58,614,671	D97V	probably benign	Het
Gm9925	A	T	18: 74,065,237		probably benign	Het
Hc	T	C	2: 35,028,046	I742V	probably benign	Het
Homer3	T	C	8: 70,291,165		probably null	Het
Hsf5	C	G	11: 87,617,294	T8S	probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Il21r	A	G	7: 125,632,585	D395G	probably damaging	Het
Kctd14	T	A	7: 97,458,012	V190E	probably damaging	Het
Mamdc4	C	G	2: 25,570,080	G57A	probably damaging	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Mtch1	A	T	17: 29,340,511		probably null	Het
Nasp	G	A	4: 116,622,782	A31V	possibly damaging	Het
Neil3	G	T	8: 53,608,739	D202E	probably damaging	Het
Nfkb1	C	T	3: 135,626,710	V95I	possibly damaging	Het
Ptpra	T	A	2: 130,537,588	M327K	probably damaging	Het
Ptprg	C	A	14: 12,213,747	F263L	probably damaging	Het
Sap30	A	G	8: 57,485,118	V155A	probably damaging	Het
Serpinb2	G	A	1: 107,524,771	V360M	probably damaging	Het
Stradb	A	G	1: 58,988,548	H79R	probably damaging	Het
Svep1	A	T	4: 58,113,458		probably null	Het
Tcaf2	A	T	6: 42,630,374	H215Q	probably benign	Het
Tdrd5	A	T	1: 156,293,377	S227T	possibly damaging	Het
Timmdc1	A	T	16: 38,518,499	Y76*	probably null	Het
Tmbim4	T	A	10: 120,221,723		probably null	Het
Tpr	A	G	1: 150,418,039	K854R	probably benign	Het
Trav6-5	A	G	14: 53,491,375	T30A	probably benign	Het
Trrap	T	A	5: 144,839,713		probably null	Het
Ube2o	A	T	11: 116,539,490	S1141T	probably benign	Het
Usp54	T	A	14: 20,583,450	K339I	probably damaging	Het
Vwf	T	G	6: 125,657,165	V202G	unknown	Het
Wdr7	T	C	18: 63,724,132	L93P	probably damaging	Het
Zfp871	CCACAC	CC	17: 32,775,520		probably null	Het

Other mutations in Heatr5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Heatr5a	APN	12	51888901	missense	probably damaging	0.99
IGL01397:Heatr5a	APN	12	51894369	missense	possibly damaging	0.89
IGL01481:Heatr5a	APN	12	51955425	missense	probably damaging	1.00
IGL01684:Heatr5a	APN	12	51955511	missense	probably benign	0.36
IGL01766:Heatr5a	APN	12	51889664	missense	probably benign	0.15
IGL01799:Heatr5a	APN	12	51897835	missense	probably benign	0.17
IGL02007:Heatr5a	APN	12	51916158	missense	probably damaging	1.00
IGL02093:Heatr5a	APN	12	51916075	missense	possibly damaging	0.68
IGL02205:Heatr5a	APN	12	51877337	missense	probably damaging	1.00
IGL02450:Heatr5a	APN	12	51945430	missense	probably benign	0.02
IGL02565:Heatr5a	APN	12	51951099	missense	possibly damaging	0.54
IGL02707:Heatr5a	APN	12	51921366	missense	probably benign	0.01
IGL02735:Heatr5a	APN	12	51915021	missense	probably damaging	0.99
IGL03160:Heatr5a	APN	12	51884496	splice site	probably benign
F5770:Heatr5a	UTSW	12	51881278	splice site	probably benign
R0034:Heatr5a	UTSW	12	51925172	missense	probably damaging	1.00
R0127:Heatr5a	UTSW	12	51925405	missense	probably benign
R0184:Heatr5a	UTSW	12	51909969	missense	probably benign	0.00
R0362:Heatr5a	UTSW	12	51888861	missense	probably damaging	1.00
R0567:Heatr5a	UTSW	12	51910089	missense	probably damaging	1.00
R0591:Heatr5a	UTSW	12	51910101	splice site	probably benign
R0736:Heatr5a	UTSW	12	51896561	critical splice donor site	probably null
R1532:Heatr5a	UTSW	12	51952518	missense	probably damaging	0.99
R1914:Heatr5a	UTSW	12	51905467	missense	probably damaging	1.00
R1956:Heatr5a	UTSW	12	51945419	critical splice donor site	probably null
R1978:Heatr5a	UTSW	12	51939658	missense	possibly damaging	0.77
R2044:Heatr5a	UTSW	12	51955403	missense	probably benign	0.19
R2263:Heatr5a	UTSW	12	51916150	missense	probably damaging	0.97
R2265:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2267:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2268:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2269:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2842:Heatr5a	UTSW	12	51955478	missense	probably null	1.00
R2842:Heatr5a	UTSW	12	51955477	splice site	probably null
R3033:Heatr5a	UTSW	12	51951038	nonsense	probably null
R4303:Heatr5a	UTSW	12	51956225	missense	probably benign	0.01
R4675:Heatr5a	UTSW	12	51877347	missense	probably benign	0.17
R4718:Heatr5a	UTSW	12	51916163	missense	possibly damaging	0.95
R4807:Heatr5a	UTSW	12	51877520	missense	probably damaging	1.00
R5114:Heatr5a	UTSW	12	51956237	nonsense	probably null
R5229:Heatr5a	UTSW	12	51947978	missense	probably benign	0.33
R5411:Heatr5a	UTSW	12	51888243	missense	probably damaging	1.00
R5548:Heatr5a	UTSW	12	51958951	nonsense	probably null
R5603:Heatr5a	UTSW	12	51877575	missense	probably benign	0.26
R5631:Heatr5a	UTSW	12	51955527	missense	probably benign	0.22
R5742:Heatr5a	UTSW	12	51955552	nonsense	probably null
R5969:Heatr5a	UTSW	12	51959040	missense	probably benign
R6020:Heatr5a	UTSW	12	51884327	missense	probably benign	0.01
R6352:Heatr5a	UTSW	12	51951166	missense	possibly damaging	0.88
R6798:Heatr5a	UTSW	12	51881265	missense	probably benign	0.01
R6815:Heatr5a	UTSW	12	51955508	missense	possibly damaging	0.89
R7059:Heatr5a	UTSW	12	51888234	missense	probably damaging	0.98
R7143:Heatr5a	UTSW	12	51961468	missense	probably benign	0.09
R7178:Heatr5a	UTSW	12	51925142	missense	probably damaging	0.99
R7291:Heatr5a	UTSW	12	51925339	missense	probably damaging	0.97
R7454:Heatr5a	UTSW	12	51961543	missense	probably benign	0.20
R7511:Heatr5a	UTSW	12	51879434	missense	possibly damaging	0.94
R7636:Heatr5a	UTSW	12	51888196	missense	probably damaging	1.00
R7636:Heatr5a	UTSW	12	51952558	missense	probably damaging	1.00
R7665:Heatr5a	UTSW	12	51961530	missense	probably damaging	1.00
R8088:Heatr5a	UTSW	12	51947996	missense	possibly damaging	0.85
R8205:Heatr5a	UTSW	12	51959009	missense	probably benign	0.05
R8212:Heatr5a	UTSW	12	51899229	missense	probably benign	0.00
R8213:Heatr5a	UTSW	12	51891443	missense	probably damaging	0.96
R8323:Heatr5a	UTSW	12	51955506	missense	probably benign	0.02
R8326:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8339:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8395:Heatr5a	UTSW	12	51916178	missense
R8410:Heatr5a	UTSW	12	51938120	missense	probably benign	0.01
R8676:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8834:Heatr5a	UTSW	12	51909956	critical splice donor site	probably null
R8916:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
V7732:Heatr5a	UTSW	12	51905324	missense	possibly damaging	0.65
Z1088:Heatr5a	UTSW	12	51891404	missense	probably damaging	1.00
Z1088:Heatr5a	UTSW	12	51951076	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- ACCAAGCGTTACATTCAGGCG -3'
(R):5'- AGAGTTTACTCGAAGCTCCTTCC -3'

Sequencing Primer
(F):5'- TACATTCAGGCGCTCAGTG -3'
(R):5'- GAAGCTCCTTCCTCCCTGAG -3'

Posted On

2018-02-28