Incidental Mutation 'R6234:Clic6'
ID504836
Institutional Source Beutler Lab
Gene Symbol Clic6
Ensembl Gene ENSMUSG00000022949
Gene Namechloride intracellular channel 6
SynonymsCLIC1L, 5730466J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location92485736-92541243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92499222 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 257 (S257P)
Ref Sequence ENSEMBL: ENSMUSP00000023670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023670] [ENSMUST00000162181]
Predicted Effect probably benign
Transcript: ENSMUST00000023670
AA Change: S257P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023670
Gene: ENSMUSG00000022949
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 38 46 N/A INTRINSIC
low complexity region 62 74 N/A INTRINSIC
low complexity region 83 108 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
Pfam:GST_N_3 375 447 2e-9 PFAM
Pfam:GST_C_2 478 567 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160494
SMART Domains Protein: ENSMUSP00000123968
Gene: ENSMUSG00000051297

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162181
SMART Domains Protein: ENSMUSP00000124498
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
Pfam:GST_N_3 34 100 2.8e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Clic6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Clic6 APN 16 92499308 missense probably damaging 0.99
IGL02104:Clic6 APN 16 92498479 missense possibly damaging 0.72
IGL02387:Clic6 APN 16 92529919 missense probably damaging 1.00
IGL02437:Clic6 APN 16 92530929 missense probably damaging 1.00
IGL02617:Clic6 APN 16 92499318 missense probably benign 0.00
unsweetened UTSW 16 92530809 missense possibly damaging 0.79
R1544:Clic6 UTSW 16 92492073 intron probably benign
R1677:Clic6 UTSW 16 92528084 missense probably damaging 1.00
R2149:Clic6 UTSW 16 92499207 missense probably benign 0.00
R3965:Clic6 UTSW 16 92498844 missense probably benign 0.00
R4171:Clic6 UTSW 16 92497061 intron probably benign
R4545:Clic6 UTSW 16 92492157 intron probably benign
R4637:Clic6 UTSW 16 92497061 intron probably benign
R4649:Clic6 UTSW 16 92530939 critical splice donor site probably null
R5159:Clic6 UTSW 16 92528066 missense probably benign 0.13
R5249:Clic6 UTSW 16 92539451 missense probably damaging 1.00
R5486:Clic6 UTSW 16 92529852 splice site probably null
R5582:Clic6 UTSW 16 92499454 missense possibly damaging 0.93
R6140:Clic6 UTSW 16 92539492 missense probably damaging 1.00
R6379:Clic6 UTSW 16 92539535 missense probably damaging 1.00
R6593:Clic6 UTSW 16 92528117 missense possibly damaging 0.82
R7890:Clic6 UTSW 16 92499387 missense probably benign 0.41
RF012:Clic6 UTSW 16 92530809 missense possibly damaging 0.79
X0058:Clic6 UTSW 16 92498707 missense probably benign
Z1176:Clic6 UTSW 16 92498895 missense probably benign 0.26
Z1177:Clic6 UTSW 16 92499139 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GACTTGCAGGGGACAACATG -3'
(R):5'- AAGTGGTTGCTGAGCTCTGC -3'

Sequencing Primer
(F):5'- CCACTTGGGTCGGAGAGTGAG -3'
(R):5'- CTGAGCTCTGCCTGGGATTC -3'
Posted On2018-02-28