Incidental Mutation 'R6234:Mtch1'
ID504837
Institutional Source Beutler Lab
Gene Symbol Mtch1
Ensembl Gene ENSMUSG00000024012
Gene Namemitochondrial carrier 1
Synonyms2310034O17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location29332072-29347904 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 29340511 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095427] [ENSMUST00000118366] [ENSMUST00000153658]
Predicted Effect probably null
Transcript: ENSMUST00000095427
SMART Domains Protein: ENSMUSP00000093077
Gene: ENSMUSG00000024012

DomainStartEndE-ValueType
low complexity region 9 64 N/A INTRINSIC
Pfam:Mito_carr 191 282 4e-10 PFAM
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118366
SMART Domains Protein: ENSMUSP00000113021
Gene: ENSMUSG00000024012

DomainStartEndE-ValueType
low complexity region 9 64 N/A INTRINSIC
Pfam:Mito_carr 191 282 3.7e-10 PFAM
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151739
Predicted Effect probably null
Transcript: ENSMUST00000153658
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitochondrial carrier family. The encoded protein is localized to the mitochondrion inner membrane and induces apoptosis independent of the proapoptotic proteins Bax and Bak. Pseudogenes on chromosomes 6 and 11 have been identified for this gene. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Mtch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Mtch1 APN 17 29340456 missense probably damaging 1.00
IGL01104:Mtch1 APN 17 29336222 missense probably damaging 0.99
IGL02728:Mtch1 APN 17 29338742 missense possibly damaging 0.55
IGL02935:Mtch1 APN 17 29336210 missense probably benign
R0070:Mtch1 UTSW 17 29340059 splice site probably benign
R0070:Mtch1 UTSW 17 29340059 splice site probably benign
R0243:Mtch1 UTSW 17 29340106 missense possibly damaging 0.78
R1136:Mtch1 UTSW 17 29333770 splice site probably null
R1829:Mtch1 UTSW 17 29338776 missense probably damaging 1.00
R2156:Mtch1 UTSW 17 29342867 missense probably damaging 1.00
R3845:Mtch1 UTSW 17 29342832 missense probably damaging 1.00
R4849:Mtch1 UTSW 17 29347591 missense probably benign 0.00
R5436:Mtch1 UTSW 17 29347590 missense probably benign 0.44
R6983:Mtch1 UTSW 17 29338776 missense probably damaging 1.00
R7465:Mtch1 UTSW 17 29332724 missense probably benign 0.00
R7939:Mtch1 UTSW 17 29340832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCGGCTAAGACTCCTTCTG -3'
(R):5'- TGATACCACTTCCTGTGCAG -3'

Sequencing Primer
(F):5'- AAGACTCCTTCTGCCCAGG -3'
(R):5'- CAAGCCTGGTGGTTATGA -3'
Posted On2018-02-28