Incidental Mutation 'R6234:Zfp871'
ID504838
Institutional Source Beutler Lab
Gene Symbol Zfp871
Ensembl Gene ENSMUSG00000024298
Gene Namezinc finger protein 871
Synonyms9030612M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6234 (G1)
Quality Score217.468
Status Validated
Chromosome17
Chromosomal Location32771236-32788287 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CCACAC to CC at 32775520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057501] [ENSMUST00000159086]
Predicted Effect probably null
Transcript: ENSMUST00000057501
SMART Domains Protein: ENSMUSP00000050501
Gene: ENSMUSG00000024298

DomainStartEndE-ValueType
KRAB 1 42 1.32e0 SMART
ZnF_C2H2 174 196 5.9e-3 SMART
ZnF_C2H2 202 224 6.32e-3 SMART
ZnF_C2H2 230 252 1.47e-3 SMART
ZnF_C2H2 258 280 3.63e-3 SMART
ZnF_C2H2 286 308 1.79e-2 SMART
ZnF_C2H2 314 336 4.79e-3 SMART
ZnF_C2H2 342 364 1.69e-3 SMART
ZnF_C2H2 370 392 2.79e-4 SMART
ZnF_C2H2 398 420 1.23e-5 SMART
ZnF_C2H2 426 448 1.2e-3 SMART
ZnF_C2H2 454 476 5.42e-2 SMART
ZnF_C2H2 482 504 8.6e-5 SMART
ZnF_C2H2 510 532 5.21e-4 SMART
ZnF_C2H2 538 560 3.11e-2 SMART
ZnF_C2H2 566 588 2.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159086
SMART Domains Protein: ENSMUSP00000127178
Gene: ENSMUSG00000024298

DomainStartEndE-ValueType
KRAB 4 61 2.18e-15 SMART
ZnF_C2H2 193 215 5.9e-3 SMART
ZnF_C2H2 221 243 6.32e-3 SMART
ZnF_C2H2 249 271 1.47e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 1.79e-2 SMART
ZnF_C2H2 333 355 4.79e-3 SMART
ZnF_C2H2 361 383 1.69e-3 SMART
ZnF_C2H2 389 411 2.79e-4 SMART
ZnF_C2H2 417 439 1.23e-5 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 5.42e-2 SMART
ZnF_C2H2 501 523 8.6e-5 SMART
ZnF_C2H2 529 551 5.21e-4 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 2.86e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168337
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Other mutations in Zfp871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp871 APN 17 32775899 missense probably benign
IGL00963:Zfp871 APN 17 32774752 missense probably benign 0.25
IGL01687:Zfp871 APN 17 32775644 missense probably benign 0.00
IGL02170:Zfp871 APN 17 32775688 missense possibly damaging 0.72
IGL02399:Zfp871 APN 17 32774355 missense probably benign 0.18
R0304:Zfp871 UTSW 17 32774434 missense probably damaging 0.99
R1215:Zfp871 UTSW 17 32775972 missense possibly damaging 0.70
R1444:Zfp871 UTSW 17 32774926 missense possibly damaging 0.85
R1754:Zfp871 UTSW 17 32775334 missense probably damaging 1.00
R1913:Zfp871 UTSW 17 32775917 missense possibly damaging 0.53
R2018:Zfp871 UTSW 17 32774777 missense probably damaging 1.00
R2180:Zfp871 UTSW 17 32775301 missense probably damaging 1.00
R2881:Zfp871 UTSW 17 32775433 missense probably damaging 1.00
R4422:Zfp871 UTSW 17 32774833 missense probably benign 0.39
R4422:Zfp871 UTSW 17 32774834 missense probably benign 0.37
R4979:Zfp871 UTSW 17 32775855 missense probably damaging 0.99
R5564:Zfp871 UTSW 17 32775868 missense possibly damaging 0.70
R6228:Zfp871 UTSW 17 32775884 missense possibly damaging 0.50
R6232:Zfp871 UTSW 17 32775520 frame shift probably null
R6233:Zfp871 UTSW 17 32775520 frame shift probably null
R6474:Zfp871 UTSW 17 32775673 missense possibly damaging 0.85
R7237:Zfp871 UTSW 17 32775315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACTGAATCCAACGCATG -3'
(R):5'- TCCAGTTCTCTCACATCATTTGAGAAC -3'

Sequencing Primer
(F):5'- GAAGGCTTTACCACACGGTTTAC -3'
(R):5'- GAATCTATAAAACTGAGCGTTGTGAC -3'
Posted On2018-02-28