Incidental Mutation 'R6234:Wdr7'
ID504839
Institutional Source Beutler Lab
Gene Symbol Wdr7
Ensembl Gene ENSMUSG00000040560
Gene NameWD repeat domain 7
SynonymsTGF-beta resistance associated gene, TRAG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location63708695-63989760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63724132 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 93 (L93P)
Ref Sequence ENSEMBL: ENSMUSP00000072509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072726]
Predicted Effect probably damaging
Transcript: ENSMUST00000072726
AA Change: L93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: L93P

DomainStartEndE-ValueType
WD40 5 47 1.2e-2 SMART
WD40 53 95 3.71e-1 SMART
Blast:WD40 145 190 1e-18 BLAST
WD40 208 242 1.77e2 SMART
WD40 453 498 3.81e-5 SMART
WD40 501 546 4.26e1 SMART
WD40 549 588 1.63e-4 SMART
low complexity region 760 777 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
low complexity region 956 970 N/A INTRINSIC
low complexity region 1020 1040 N/A INTRINSIC
low complexity region 1181 1192 N/A INTRINSIC
Blast:WD40 1341 1380 5e-20 BLAST
WD40 1382 1422 2.73e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Wdr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Wdr7 APN 18 63720775 missense possibly damaging 0.83
IGL00708:Wdr7 APN 18 63778033 missense probably benign 0.42
IGL00813:Wdr7 APN 18 63735604 missense possibly damaging 0.84
IGL00840:Wdr7 APN 18 63927327 missense possibly damaging 0.80
IGL00904:Wdr7 APN 18 63796231 missense probably benign 0.43
IGL00930:Wdr7 APN 18 63740244 nonsense probably null
IGL01481:Wdr7 APN 18 63739179 missense probably damaging 1.00
IGL02121:Wdr7 APN 18 63777545 nonsense probably null
IGL02346:Wdr7 APN 18 63865336 missense probably benign 0.09
IGL02454:Wdr7 APN 18 63796228 missense probably benign 0.20
IGL02538:Wdr7 APN 18 63796235 missense probably benign 0.01
IGL02870:Wdr7 APN 18 63791843 missense probably benign
IGL03054:Wdr7 APN 18 63825121 splice site probably benign
IGL03189:Wdr7 APN 18 63760601 missense probably benign 0.17
R0014:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0022:Wdr7 UTSW 18 63777634 missense probably damaging 1.00
R0233:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0432:Wdr7 UTSW 18 63796249 missense probably damaging 0.96
R0496:Wdr7 UTSW 18 63791843 missense probably benign
R0633:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R0931:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R1585:Wdr7 UTSW 18 63924918 missense probably benign 0.03
R1651:Wdr7 UTSW 18 63720776 nonsense probably null
R1804:Wdr7 UTSW 18 63865440 missense probably damaging 1.00
R1874:Wdr7 UTSW 18 63728504 missense probably benign 0.02
R1985:Wdr7 UTSW 18 63760583 frame shift probably null
R2106:Wdr7 UTSW 18 63778038 missense probably damaging 1.00
R2206:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2207:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2245:Wdr7 UTSW 18 63924909 missense possibly damaging 0.60
R2407:Wdr7 UTSW 18 63760723 missense probably benign
R3804:Wdr7 UTSW 18 63720836 missense probably benign
R3880:Wdr7 UTSW 18 63724155 missense possibly damaging 0.92
R4410:Wdr7 UTSW 18 63778249 missense probably damaging 1.00
R4441:Wdr7 UTSW 18 63755210 missense probably damaging 1.00
R4485:Wdr7 UTSW 18 63777550 missense possibly damaging 0.89
R4606:Wdr7 UTSW 18 63779945 nonsense probably null
R4607:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4608:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4711:Wdr7 UTSW 18 63728465 missense probably benign
R4852:Wdr7 UTSW 18 63777949 missense probably damaging 0.98
R5197:Wdr7 UTSW 18 63738866 missense probably benign 0.02
R5213:Wdr7 UTSW 18 63755126 missense probably damaging 1.00
R5280:Wdr7 UTSW 18 63987312 missense probably benign 0.35
R5378:Wdr7 UTSW 18 63825239 critical splice donor site probably null
R6076:Wdr7 UTSW 18 63739277 missense probably damaging 1.00
R6083:Wdr7 UTSW 18 63728469 missense probably damaging 1.00
R6168:Wdr7 UTSW 18 63777977 missense probably damaging 0.98
R6295:Wdr7 UTSW 18 63755111 missense probably damaging 1.00
R6548:Wdr7 UTSW 18 63778251 missense possibly damaging 0.87
R6566:Wdr7 UTSW 18 63755055 missense possibly damaging 0.72
R6696:Wdr7 UTSW 18 63739330 missense probably benign 0.07
R6937:Wdr7 UTSW 18 63791867 missense probably benign
R6962:Wdr7 UTSW 18 63865288 missense possibly damaging 0.74
R7162:Wdr7 UTSW 18 63724139 missense possibly damaging 0.92
R7376:Wdr7 UTSW 18 63777620 missense probably damaging 1.00
R7423:Wdr7 UTSW 18 63777380 splice site probably null
R7781:Wdr7 UTSW 18 63777789 nonsense probably null
R7851:Wdr7 UTSW 18 63720327 missense probably benign 0.05
R7962:Wdr7 UTSW 18 63904086 missense probably damaging 1.00
R8310:Wdr7 UTSW 18 63735685 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGAAGTGGGGCATTGAC -3'
(R):5'- TTCCATAAGTGCAACCGGTG -3'

Sequencing Primer
(F):5'- CATTGACAGGTTGGAAATGGGGTC -3'
(R):5'- GAGACTGACTGACTAGGTTTCTCAC -3'
Posted On2018-02-28