Incidental Mutation 'R6234:Chmp1b'
ID504840
Institutional Source Beutler Lab
Gene Symbol Chmp1b
Ensembl Gene ENSMUSG00000109901
Gene Namecharged multivesicular body protein 1B
Synonyms2810405I11Rik, chromatin modifying protein 1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R6234 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location67203531-67207880 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 67206098 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 200 (*200R)
Ref Sequence ENSEMBL: ENSMUSP00000147285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025402] [ENSMUST00000076605] [ENSMUST00000210564]
Predicted Effect probably benign
Transcript: ENSMUST00000025402
SMART Domains Protein: ENSMUSP00000025402
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
G_alpha 89 447 1.18e-172 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076605
SMART Domains Protein: ENSMUSP00000075908
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
G_alpha 22 380 5.02e-176 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209359
Predicted Effect probably null
Transcript: ENSMUST00000210564
AA Change: *200R
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHMP1B belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Chmp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
U24488:Chmp1b UTSW 18 67205874 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTCGAGACTCTGGACGTC -3'
(R):5'- GAACCAGTTCTGTTAAAAGGCAGC -3'

Sequencing Primer
(F):5'- TCCAGACGCAGCAAATGG -3'
(R):5'- CACATCATCATAAGCTAGAAAGAGC -3'
Posted On2018-02-28