Incidental Mutation 'R6234:Dnase1l1'
ID504842
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Namedeoxyribonuclease 1-like 1
SynonymsDnase1ll, G4.8, Dnl1ll, 2310005K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6234 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location74273217-74282337 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74277038 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000151702] [ENSMUST00000135690]
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4752:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4753:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4814:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4815:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4846:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4861:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4862:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4872:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4873:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4875:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4978:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4979:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4980:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4981:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4982:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4983:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5039:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5084:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5085:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5086:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5087:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5106:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5107:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5108:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5109:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5137:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5171:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5266:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5296:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5330:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5417:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5418:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5419:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5448:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5466:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5467:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6126:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6128:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6129:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6130:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6232:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6233:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6242:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6305:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6306:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6329:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6343:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6344:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6396:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6397:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6449:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6585:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6586:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6646:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6679:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6681:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6845:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6847:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGATTGGTACCAGAGTGGCTG -3'
(R):5'- ACCTGGATTCCTTTGGAGGG -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On2018-02-28