Incidental Mutation 'R6235:Ddx31'
ID504844
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28840406-28905571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 28844842 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 5 (A5G)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037117] [ENSMUST00000113853] [ENSMUST00000171404]
Predicted Effect probably benign
Transcript: ENSMUST00000037117
SMART Domains Protein: ENSMUSP00000042265
Gene: ENSMUSG00000035666

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:TFIIIC_delta 59 250 1.1e-45 PFAM
low complexity region 609 621 N/A INTRINSIC
Pfam:zf-TFIIIC 728 816 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113853
AA Change: A5G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: A5G

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156468
Predicted Effect probably benign
Transcript: ENSMUST00000171404
SMART Domains Protein: ENSMUSP00000132171
Gene: ENSMUSG00000035666

DomainStartEndE-ValueType
Pfam:TFIIIC_delta 7 109 3.1e-17 PFAM
low complexity region 468 480 N/A INTRINSIC
Pfam:zf-TFIIIC 587 676 4.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R0729:Ddx31 UTSW 2 28874174 missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28857175 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28874173 missense probably damaging 1.00
R6245:Ddx31 UTSW 2 28844982 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6647:Ddx31 UTSW 2 28875738 missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28874176 missense probably benign 0.26
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
R7819:Ddx31 UTSW 2 28892451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGATTGTGTGTCTTCCCC -3'
(R):5'- ACAGCGATGAAGTCTTGATGC -3'

Sequencing Primer
(F):5'- CCCATTTCAGATGAAGCCAAAG -3'
(R):5'- GAAGTCTTGATGCATGGCTTCTCC -3'
Posted On2018-02-28