Incidental Mutation 'R6235:Ntng2'
ID 504845
Institutional Source Beutler Lab
Gene Symbol Ntng2
Ensembl Gene ENSMUSG00000035513
Gene Name netrin G2
Synonyms Lmnt2, 2610016D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R6235 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 29194541-29253005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 29227979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 152 (E152D)
Ref Sequence ENSEMBL: ENSMUSP00000099937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048455] [ENSMUST00000071201] [ENSMUST00000091153] [ENSMUST00000102873] [ENSMUST00000177689] [ENSMUST00000183583]
AlphaFold Q8R4F1
Predicted Effect probably damaging
Transcript: ENSMUST00000048455
AA Change: E152D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035468
Gene: ENSMUSG00000035513
AA Change: E152D

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 372 385 N/A INTRINSIC
EGF_Lam 413 466 5.28e-5 SMART
EGF_Lam 469 511 4.12e-7 SMART
EGF 515 547 2.26e-4 SMART
low complexity region 574 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071201
AA Change: E152D

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071190
Gene: ENSMUSG00000035513
AA Change: E152D

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 346 9.19e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091153
AA Change: E152D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088688
Gene: ENSMUSG00000035513
AA Change: E152D

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 388 441 5.28e-5 SMART
EGF_Lam 444 486 4.12e-7 SMART
EGF 490 522 2.26e-4 SMART
low complexity region 549 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102873
AA Change: E152D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099937
Gene: ENSMUSG00000035513
AA Change: E152D

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149096
Predicted Effect probably damaging
Transcript: ENSMUST00000177689
AA Change: E152D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136659
Gene: ENSMUSG00000035513
AA Change: E152D

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183583
AA Change: E152D

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139034
Gene: ENSMUSG00000035513
AA Change: E152D

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 345 368 N/A INTRINSIC
Meta Mutation Damage Score 0.2335 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a subclass of the netrin family called netrin-G proteins. Unlike classic netrins, which act as diffusible chemoattractants, netrin-Gs are glycosylphosphatidylinositol-anchored membrane proteins that interact with specific transmembrane proteins. In mouse, this gene is preferentially expressed in the cerebral cortex, habenular nucleus and superior colliculus. Knockout mutant mice display a lack of behavioral startle in response to acoustic stimuli. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an absence of startle reflex and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Ntng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0388:Ntng2 UTSW 2 29207426 missense probably damaging 1.00
R0526:Ntng2 UTSW 2 29197062 missense probably damaging 1.00
R1835:Ntng2 UTSW 2 29197057 nonsense probably null
R1961:Ntng2 UTSW 2 29197098 missense probably damaging 1.00
R2507:Ntng2 UTSW 2 29207519 missense probably damaging 1.00
R2920:Ntng2 UTSW 2 29204211 missense probably benign
R3944:Ntng2 UTSW 2 29204277 missense probably benign 0.02
R3954:Ntng2 UTSW 2 29207535 missense probably damaging 0.97
R6742:Ntng2 UTSW 2 29200928 missense probably benign
R6751:Ntng2 UTSW 2 29228043 missense possibly damaging 0.89
R6774:Ntng2 UTSW 2 29197090 missense probably damaging 1.00
R6907:Ntng2 UTSW 2 29228206 missense probably damaging 1.00
R6964:Ntng2 UTSW 2 29197029 missense probably benign 0.02
R6995:Ntng2 UTSW 2 29197068 missense probably damaging 1.00
R7214:Ntng2 UTSW 2 29227720 missense probably damaging 0.99
R7249:Ntng2 UTSW 2 29227992 missense probably benign 0.03
R7825:Ntng2 UTSW 2 29204078 missense probably benign 0.00
R8337:Ntng2 UTSW 2 29248038 start codon destroyed probably null 0.88
R8775:Ntng2 UTSW 2 29227964 missense possibly damaging 0.63
R8775-TAIL:Ntng2 UTSW 2 29227964 missense possibly damaging 0.63
R9058:Ntng2 UTSW 2 29204190 missense probably benign
R9203:Ntng2 UTSW 2 29194986 nonsense probably null
R9319:Ntng2 UTSW 2 29201109 intron probably benign
R9411:Ntng2 UTSW 2 29248036 missense probably damaging 1.00
R9480:Ntng2 UTSW 2 29247985 missense probably damaging 0.99
R9512:Ntng2 UTSW 2 29227957 missense possibly damaging 0.89
X0023:Ntng2 UTSW 2 29197063 nonsense probably null
X0028:Ntng2 UTSW 2 29197149 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTACCTCAAAGCGCACATGC -3'
(R):5'- ATGAGTGTGATGCCTCCAATCC -3'

Sequencing Primer
(F):5'- GCACATGCTTCTCTTTCTTGGAC -3'
(R):5'- CCCCGGCTTATGTTTGACAGG -3'
Posted On 2018-02-28