Incidental Mutation 'R6235:Mpdz'
ID504855
Institutional Source Beutler Lab
Gene Symbol Mpdz
Ensembl Gene ENSMUSG00000028402
Gene Namemultiple PDZ domain protein
SynonymsB930003D11Rik, MUPP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location81278500-81442815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81385281 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 140 (E140G)
Ref Sequence ENSEMBL: ENSMUSP00000152533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000220807]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102830
AA Change: E140G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: E140G

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1111 1126 N/A INTRINSIC
PDZ 1148 1231 2.43e-22 SMART
low complexity region 1233 1251 N/A INTRINSIC
PDZ 1346 1421 3.41e-17 SMART
low complexity region 1434 1445 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
PDZ 1479 1552 2.69e-15 SMART
PDZ 1622 1697 3.2e-22 SMART
PDZ 1719 1792 3.62e-21 SMART
low complexity region 1798 1815 N/A INTRINSIC
PDZ 1856 1933 9.79e-18 SMART
PDZ 1980 2055 2.39e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107258
AA Change: E140G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: E140G

DomainStartEndE-ValueType
PDZ 1 73 3.42e-8 SMART
low complexity region 104 119 N/A INTRINSIC
PDZ 141 224 2.43e-22 SMART
PDZ 306 381 3.41e-17 SMART
low complexity region 394 405 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
PDZ 439 512 2.69e-15 SMART
PDZ 582 657 3.2e-22 SMART
PDZ 679 752 3.62e-21 SMART
low complexity region 758 775 N/A INTRINSIC
PDZ 816 893 9.79e-18 SMART
PDZ 940 1015 2.39e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107262
AA Change: E140G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: E140G

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1112 1127 N/A INTRINSIC
PDZ 1149 1232 2.43e-22 SMART
low complexity region 1234 1252 N/A INTRINSIC
PDZ 1347 1422 3.41e-17 SMART
low complexity region 1435 1446 N/A INTRINSIC
low complexity region 1455 1469 N/A INTRINSIC
PDZ 1480 1553 2.69e-15 SMART
PDZ 1623 1698 3.2e-22 SMART
PDZ 1720 1793 3.62e-21 SMART
low complexity region 1799 1816 N/A INTRINSIC
PDZ 1857 1934 9.79e-18 SMART
PDZ 1981 2056 2.39e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220807
AA Change: E140G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Mpdz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mpdz APN 4 81310224 nonsense probably null
IGL00325:Mpdz APN 4 81317631 missense probably damaging 1.00
IGL00497:Mpdz APN 4 81335742 missense probably benign 0.30
IGL00502:Mpdz APN 4 81369723 missense probably damaging 1.00
IGL00539:Mpdz APN 4 81361351 missense possibly damaging 0.83
IGL00938:Mpdz APN 4 81292512 missense probably damaging 1.00
IGL00990:Mpdz APN 4 81303584 splice site probably benign
IGL01394:Mpdz APN 4 81292491 missense possibly damaging 0.92
IGL01537:Mpdz APN 4 81369658 missense probably damaging 0.98
IGL01558:Mpdz APN 4 81295530 nonsense probably null
IGL01561:Mpdz APN 4 81284614 missense probably damaging 1.00
IGL01649:Mpdz APN 4 81303633 missense probably damaging 0.98
IGL01743:Mpdz APN 4 81317682 missense probably damaging 1.00
IGL01941:Mpdz APN 4 81286387 missense possibly damaging 0.91
IGL01969:Mpdz APN 4 81358724 missense probably damaging 0.98
IGL02023:Mpdz APN 4 81329529 missense probably damaging 0.99
IGL02081:Mpdz APN 4 81335869 missense probably damaging 1.00
IGL02304:Mpdz APN 4 81310157 missense possibly damaging 0.78
IGL02304:Mpdz APN 4 81297559 splice site probably benign
IGL02410:Mpdz APN 4 81297493 missense probably benign 0.13
IGL02449:Mpdz APN 4 81329422 splice site probably null
IGL02671:Mpdz APN 4 81290273 missense probably damaging 1.00
IGL02708:Mpdz APN 4 81284571 splice site probably null
IGL02718:Mpdz APN 4 81385202 missense probably damaging 1.00
IGL03065:Mpdz APN 4 81292565 missense probably damaging 0.98
IGL03378:Mpdz APN 4 81419048 splice site probably benign
PIT4458001:Mpdz UTSW 4 81419026 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0119:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0402:Mpdz UTSW 4 81361440 missense possibly damaging 0.51
R0499:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0718:Mpdz UTSW 4 81292473 missense possibly damaging 0.79
R0844:Mpdz UTSW 4 81421194 start gained probably benign
R0883:Mpdz UTSW 4 81359991 splice site probably benign
R0885:Mpdz UTSW 4 81369592 missense probably benign 0.04
R1344:Mpdz UTSW 4 81308319 missense probably benign 0.01
R1432:Mpdz UTSW 4 81292551 missense probably damaging 1.00
R1488:Mpdz UTSW 4 81348708 nonsense probably null
R1589:Mpdz UTSW 4 81421176 missense probably benign 0.00
R1756:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R1940:Mpdz UTSW 4 81361443 missense probably benign 0.01
R2068:Mpdz UTSW 4 81335830 missense probably null 1.00
R2182:Mpdz UTSW 4 81348722 missense probably damaging 1.00
R2213:Mpdz UTSW 4 81310172 missense probably damaging 0.99
R2265:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2268:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2269:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R3082:Mpdz UTSW 4 81285458 splice site probably benign
R3746:Mpdz UTSW 4 81363147 missense probably damaging 1.00
R3902:Mpdz UTSW 4 81307116 missense probably damaging 1.00
R4095:Mpdz UTSW 4 81383823 missense possibly damaging 0.77
R4097:Mpdz UTSW 4 81335700 missense probably damaging 1.00
R4206:Mpdz UTSW 4 81381762 missense probably benign 0.13
R4675:Mpdz UTSW 4 81383812 missense probably damaging 0.98
R4884:Mpdz UTSW 4 81361476 missense probably damaging 0.97
R5044:Mpdz UTSW 4 81381697 missense probably benign 0.16
R5050:Mpdz UTSW 4 81295448 missense probably benign 0.00
R5243:Mpdz UTSW 4 81306879 missense probably damaging 1.00
R5332:Mpdz UTSW 4 81292580 missense probably damaging 1.00
R5435:Mpdz UTSW 4 81283487 intron probably benign
R5720:Mpdz UTSW 4 81287694 missense probably damaging 0.99
R5743:Mpdz UTSW 4 81421188 start codon destroyed probably null 0.30
R5764:Mpdz UTSW 4 81356446 missense probably benign 0.13
R5876:Mpdz UTSW 4 81285474 nonsense probably null
R5938:Mpdz UTSW 4 81284614 missense probably damaging 1.00
R5988:Mpdz UTSW 4 81284575 critical splice donor site probably null
R6125:Mpdz UTSW 4 81297527 missense probably benign 0.00
R6178:Mpdz UTSW 4 81308365 missense probably damaging 1.00
R6293:Mpdz UTSW 4 81360056 missense probably damaging 1.00
R6387:Mpdz UTSW 4 81381709 missense possibly damaging 0.69
R6488:Mpdz UTSW 4 81287733 missense probably benign 0.11
R6536:Mpdz UTSW 4 81383417 missense probably damaging 1.00
R6673:Mpdz UTSW 4 81356430 missense probably benign 0.11
R6879:Mpdz UTSW 4 81348656 missense possibly damaging 0.81
R7180:Mpdz UTSW 4 81335751 missense probably damaging 0.98
R7199:Mpdz UTSW 4 81297333 missense probably damaging 0.98
R7209:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R7309:Mpdz UTSW 4 81381958 intron probably null
R7359:Mpdz UTSW 4 81356395 missense probably benign 0.01
R7561:Mpdz UTSW 4 81307151 missense probably damaging 0.99
R7565:Mpdz UTSW 4 81303654 missense probably benign 0.01
R7738:Mpdz UTSW 4 81335749 missense probably benign 0.01
R8074:Mpdz UTSW 4 81349087 missense probably benign 0.00
RF013:Mpdz UTSW 4 81293592 missense possibly damaging 0.60
X0011:Mpdz UTSW 4 81292759 critical splice donor site probably null
Z1177:Mpdz UTSW 4 81320490 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAAAACCCTTCTGTGTGTAC -3'
(R):5'- CGCAATGAAGGCAGCATAGC -3'

Sequencing Primer
(F):5'- CCCTTCTGTGTGTACATTTAGAAG -3'
(R):5'- AACCTGCTCAGTCTGTATAATGTTC -3'
Posted On2018-02-28