Mutagenetix > Incidental Mutations

Incidental Mutation 'R6235:Mpdz'

504855

Institutional Source

Beutler Lab

Gene Symbol

Mpdz

Ensembl Gene

ENSMUSG00000028402

Gene Name

multiple PDZ domain protein

Synonyms

B930003D11Rik, MUPP1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6235 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81278500-81442815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81385281 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 140 (E140G)

Ref Sequence

ENSEMBL: ENSMUSP00000152533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000220807]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102830
AA Change: E140G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: E140G

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1111	1126	N/A	INTRINSIC
PDZ	1148	1231	2.43e-22	SMART
low complexity region	1233	1251	N/A	INTRINSIC
PDZ	1346	1421	3.41e-17	SMART
low complexity region	1434	1445	N/A	INTRINSIC
low complexity region	1454	1468	N/A	INTRINSIC
PDZ	1479	1552	2.69e-15	SMART
PDZ	1622	1697	3.2e-22	SMART
PDZ	1719	1792	3.62e-21	SMART
low complexity region	1798	1815	N/A	INTRINSIC
PDZ	1856	1933	9.79e-18	SMART
PDZ	1980	2055	2.39e-21	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107258
AA Change: E140G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: E140G

Domain	Start	End	E-Value	Type
PDZ	1	73	3.42e-8	SMART
low complexity region	104	119	N/A	INTRINSIC
PDZ	141	224	2.43e-22	SMART
PDZ	306	381	3.41e-17	SMART
low complexity region	394	405	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
PDZ	439	512	2.69e-15	SMART
PDZ	582	657	3.2e-22	SMART
PDZ	679	752	3.62e-21	SMART
low complexity region	758	775	N/A	INTRINSIC
PDZ	816	893	9.79e-18	SMART
PDZ	940	1015	2.39e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107262
AA Change: E140G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: E140G

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1112	1127	N/A	INTRINSIC
PDZ	1149	1232	2.43e-22	SMART
low complexity region	1234	1252	N/A	INTRINSIC
PDZ	1347	1422	3.41e-17	SMART
low complexity region	1435	1446	N/A	INTRINSIC
low complexity region	1455	1469	N/A	INTRINSIC
PDZ	1480	1553	2.69e-15	SMART
PDZ	1623	1698	3.2e-22	SMART
PDZ	1720	1793	3.62e-21	SMART
low complexity region	1799	1816	N/A	INTRINSIC
PDZ	1857	1934	9.79e-18	SMART
PDZ	1981	2056	2.39e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000220807
AA Change: E140G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	T	C	12: 113,491,710	F716L	probably benign	Het
Akip1	A	G	7: 109,707,413	M106V	probably benign	Het
Aldh1l1	A	T	6: 90,564,457	I278F	probably benign	Het
Aplnr	A	G	2: 85,137,626	T332A	probably benign	Het
Aqp4	A	G	18: 15,398,113	V197A	probably damaging	Het
Arid4a	A	T	12: 71,069,772		probably null	Het
Baiap2	A	T	11: 119,981,408	N99Y	probably damaging	Het
Ceacam1	A	T	7: 25,471,792		probably null	Het
Cep78	T	C	19: 15,976,486		probably null	Het
Cldn3	T	C	5: 134,986,719	F92S	possibly damaging	Het
Clec16a	C	A	16: 10,694,635	P812Q	probably damaging	Het
Cnga4	T	G	7: 105,407,699	Y336*	probably null	Het
Copg2	A	G	6: 30,816,071	I443T	probably damaging	Het
Crhbp	C	A	13: 95,443,850	A81S	probably damaging	Het
Csad	A	T	15: 102,178,606	V410D	probably damaging	Het
Ctps	G	A	4: 120,558,806	L207F	probably benign	Het
Dab2ip	A	G	2: 35,723,087	E1003G	probably damaging	Het
Ddx31	C	G	2: 28,844,842	A5G	probably benign	Het
Dnah12	A	T	14: 26,854,804	I3004F	probably damaging	Het
Fbxo15	A	G	18: 84,980,904		probably benign	Het
Fbxw28	C	A	9: 109,326,190	W356C	probably damaging	Het
Gimap6	G	T	6: 48,702,457	T215K	probably benign	Het
Gm5346	T	G	8: 43,625,912	N425T	probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Hunk	A	G	16: 90,432,706	I152V	probably damaging	Het
Itk	T	C	11: 46,336,428	E456G	probably benign	Het
Krt40	G	A	11: 99,543,094	A22V	possibly damaging	Het
Lars2	T	C	9: 123,411,880	V204A	probably damaging	Het
Lipo1	A	G	19: 33,783,563	Y140H	probably damaging	Het
Lrp1	G	A	10: 127,588,177	R809W	probably damaging	Het
Magi3	C	T	3: 104,016,068	G1111D	probably damaging	Het
Mis18bp1	A	T	12: 65,158,408	V47E	probably damaging	Het
Myo1d	T	C	11: 80,692,944	I81V	probably benign	Het
Nek10	T	A	14: 14,821,113	Y26*	probably null	Het
Ntng2	C	A	2: 29,227,979	E152D	probably damaging	Het
Olfr1036	T	C	2: 86,075,166	L142P	possibly damaging	Het
Olfr1490	C	A	19: 13,654,781	C117*	probably null	Het
Otud3	A	T	4: 138,901,901	V185D	probably damaging	Het
Parp6	C	T	9: 59,630,815	R248W	probably benign	Het
Pcdhga7	A	G	18: 37,716,430	T497A	probably benign	Het
Ppp1r18	A	G	17: 35,873,877	E140G	probably damaging	Het
Prl3b1	T	C	13: 27,247,945	L151P	probably damaging	Het
Pth1r	C	T	9: 110,722,316	E572K	possibly damaging	Het
Ptprq	T	A	10: 107,635,338	T1401S	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,516	T480A	possibly damaging	Het
Rax	T	A	18: 65,935,161	Q291L	unknown	Het
Reck	T	C	4: 43,937,450	L734P	probably damaging	Het
Rgmb	A	G	17: 15,820,819	F169L	probably damaging	Het
Rhobtb3	T	C	13: 75,892,910	I426M	probably damaging	Het
Ring1	C	A	17: 34,023,306	A76S	probably damaging	Het
Robo3	T	G	9: 37,420,929	Y891S	probably damaging	Het
Rpusd2	A	G	2: 119,034,857	I12V	probably benign	Het
Rragd	T	C	4: 32,995,985	V165A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Ryr1	G	T	7: 29,116,181	Q95K	probably benign	Het
S1pr4	T	A	10: 81,498,882	N253Y	possibly damaging	Het
Scn3a	A	C	2: 65,461,335	V1689G	probably damaging	Het
Sdhb	A	G	4: 140,973,673	N147D	probably damaging	Het
Sdk1	A	T	5: 142,034,426	H913L	possibly damaging	Het
Serpina3i	T	A	12: 104,266,532	M232K	probably damaging	Het
Sipa1l2	A	T	8: 125,474,871	V646E	probably damaging	Het
Slc38a1	A	T	15: 96,578,792	I396N	probably benign	Het
Slc6a13	A	T	6: 121,302,794	E42D	probably benign	Het
Stard9	G	A	2: 120,713,546	V4442M	probably damaging	Het
Sumo3	T	A	10: 77,616,237		probably benign	Het
Syngap1	A	G	17: 26,958,130	I356V	probably benign	Het
Tcam1	C	T	11: 106,284,054	Q112*	probably null	Het
Tdp2	T	A	13: 24,840,395	L225*	probably null	Het
Tmprss7	A	G	16: 45,658,122	V747A	probably benign	Het
Ugt2b34	T	A	5: 86,906,364	Y186F	probably benign	Het
Usp37	G	T	1: 74,475,133	S293*	probably null	Het
Vmn1r36	A	G	6: 66,716,246	I109T	probably benign	Het
Vsig10l	T	A	7: 43,468,972	V798E	probably benign	Het
Zfp36l1	G	T	12: 80,112,822	C18*	probably null	Het
Zfp959	T	C	17: 55,897,427	Y152H	probably damaging	Het
Zfyve26	A	T	12: 79,249,599	C1949S	probably damaging	Het
Zswim9	T	A	7: 13,261,603	E209V	probably damaging	Het

Other mutations in Mpdz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Mpdz	APN	4	81310224	nonsense	probably null
IGL00325:Mpdz	APN	4	81317631	missense	probably damaging	1.00
IGL00497:Mpdz	APN	4	81335742	missense	probably benign	0.30
IGL00502:Mpdz	APN	4	81369723	missense	probably damaging	1.00
IGL00539:Mpdz	APN	4	81361351	missense	possibly damaging	0.83
IGL00938:Mpdz	APN	4	81292512	missense	probably damaging	1.00
IGL00990:Mpdz	APN	4	81303584	splice site	probably benign
IGL01394:Mpdz	APN	4	81292491	missense	possibly damaging	0.92
IGL01537:Mpdz	APN	4	81369658	missense	probably damaging	0.98
IGL01558:Mpdz	APN	4	81295530	nonsense	probably null
IGL01561:Mpdz	APN	4	81284614	missense	probably damaging	1.00
IGL01649:Mpdz	APN	4	81303633	missense	probably damaging	0.98
IGL01743:Mpdz	APN	4	81317682	missense	probably damaging	1.00
IGL01941:Mpdz	APN	4	81286387	missense	possibly damaging	0.91
IGL01969:Mpdz	APN	4	81358724	missense	probably damaging	0.98
IGL02023:Mpdz	APN	4	81329529	missense	probably damaging	0.99
IGL02081:Mpdz	APN	4	81335869	missense	probably damaging	1.00
IGL02304:Mpdz	APN	4	81310157	missense	possibly damaging	0.78
IGL02304:Mpdz	APN	4	81297559	splice site	probably benign
IGL02410:Mpdz	APN	4	81297493	missense	probably benign	0.13
IGL02449:Mpdz	APN	4	81329422	splice site	probably null
IGL02671:Mpdz	APN	4	81290273	missense	probably damaging	1.00
IGL02708:Mpdz	APN	4	81284571	splice site	probably null
IGL02718:Mpdz	APN	4	81385202	missense	probably damaging	1.00
IGL03065:Mpdz	APN	4	81292565	missense	probably damaging	0.98
IGL03378:Mpdz	APN	4	81419048	splice site	probably benign
PIT4458001:Mpdz	UTSW	4	81419026	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0119:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0402:Mpdz	UTSW	4	81361440	missense	possibly damaging	0.51
R0499:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0718:Mpdz	UTSW	4	81292473	missense	possibly damaging	0.79
R0844:Mpdz	UTSW	4	81421194	start gained	probably benign
R0883:Mpdz	UTSW	4	81359991	splice site	probably benign
R0885:Mpdz	UTSW	4	81369592	missense	probably benign	0.04
R1344:Mpdz	UTSW	4	81308319	missense	probably benign	0.01
R1432:Mpdz	UTSW	4	81292551	missense	probably damaging	1.00
R1488:Mpdz	UTSW	4	81348708	nonsense	probably null
R1589:Mpdz	UTSW	4	81421176	missense	probably benign	0.00
R1756:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R1940:Mpdz	UTSW	4	81361443	missense	probably benign	0.01
R2068:Mpdz	UTSW	4	81335830	missense	probably null	1.00
R2182:Mpdz	UTSW	4	81348722	missense	probably damaging	1.00
R2213:Mpdz	UTSW	4	81310172	missense	probably damaging	0.99
R2265:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2268:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2269:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R3082:Mpdz	UTSW	4	81285458	splice site	probably benign
R3746:Mpdz	UTSW	4	81363147	missense	probably damaging	1.00
R3902:Mpdz	UTSW	4	81307116	missense	probably damaging	1.00
R4095:Mpdz	UTSW	4	81383823	missense	possibly damaging	0.77
R4097:Mpdz	UTSW	4	81335700	missense	probably damaging	1.00
R4206:Mpdz	UTSW	4	81381762	missense	probably benign	0.13
R4675:Mpdz	UTSW	4	81383812	missense	probably damaging	0.98
R4884:Mpdz	UTSW	4	81361476	missense	probably damaging	0.97
R5044:Mpdz	UTSW	4	81381697	missense	probably benign	0.16
R5050:Mpdz	UTSW	4	81295448	missense	probably benign	0.00
R5243:Mpdz	UTSW	4	81306879	missense	probably damaging	1.00
R5332:Mpdz	UTSW	4	81292580	missense	probably damaging	1.00
R5435:Mpdz	UTSW	4	81283487	intron	probably benign
R5720:Mpdz	UTSW	4	81287694	missense	probably damaging	0.99
R5743:Mpdz	UTSW	4	81421188	start codon destroyed	probably null	0.30
R5764:Mpdz	UTSW	4	81356446	missense	probably benign	0.13
R5876:Mpdz	UTSW	4	81285474	nonsense	probably null
R5938:Mpdz	UTSW	4	81284614	missense	probably damaging	1.00
R5988:Mpdz	UTSW	4	81284575	critical splice donor site	probably null
R6125:Mpdz	UTSW	4	81297527	missense	probably benign	0.00
R6178:Mpdz	UTSW	4	81308365	missense	probably damaging	1.00
R6293:Mpdz	UTSW	4	81360056	missense	probably damaging	1.00
R6387:Mpdz	UTSW	4	81381709	missense	possibly damaging	0.69
R6488:Mpdz	UTSW	4	81287733	missense	probably benign	0.11
R6536:Mpdz	UTSW	4	81383417	missense	probably damaging	1.00
R6673:Mpdz	UTSW	4	81356430	missense	probably benign	0.11
R6879:Mpdz	UTSW	4	81348656	missense	possibly damaging	0.81
R7180:Mpdz	UTSW	4	81335751	missense	probably damaging	0.98
R7199:Mpdz	UTSW	4	81297333	missense	probably damaging	0.98
R7209:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R7309:Mpdz	UTSW	4	81381958	splice site	probably null
R7359:Mpdz	UTSW	4	81356395	missense	probably benign	0.01
R7561:Mpdz	UTSW	4	81307151	missense	probably damaging	0.99
R7565:Mpdz	UTSW	4	81303654	missense	probably benign	0.01
R7738:Mpdz	UTSW	4	81335749	missense	probably benign	0.01
R7941:Mpdz	UTSW	4	81282750	missense	probably benign	0.04
R8074:Mpdz	UTSW	4	81349087	missense	probably benign	0.00
RF013:Mpdz	UTSW	4	81293592	missense	possibly damaging	0.60
X0011:Mpdz	UTSW	4	81292759	critical splice donor site	probably null
Z1177:Mpdz	UTSW	4	81320490	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCAAAACCCTTCTGTGTGTAC -3'
(R):5'- CGCAATGAAGGCAGCATAGC -3'

Sequencing Primer
(F):5'- CCCTTCTGTGTGTACATTTAGAAG -3'
(R):5'- AACCTGCTCAGTCTGTATAATGTTC -3'

Posted On

2018-02-28