Incidental Mutation 'R6235:Ctps'
ID504856
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120558806 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 207 (L207F)
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably benign
Transcript: ENSMUST00000030381
AA Change: L207F

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633
AA Change: L207F

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R1053:Ctps UTSW 4 120543722 splice site probably null
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3736:Ctps UTSW 4 120543746 missense probably benign
R3928:Ctps UTSW 4 120541896 missense probably benign
R3929:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5045:Ctps UTSW 4 120552878 critical splice donor site probably null
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6828:Ctps UTSW 4 120548138 missense probably damaging 1.00
R7232:Ctps UTSW 4 120548124 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Z1176:Ctps UTSW 4 120542743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGAGCTAACTGACAGGTTTTCC -3'
(R):5'- TCTAGGCTGAAGTGTACAACTG -3'

Sequencing Primer
(F):5'- CCTCCTTAATGTTCTTGGGAGG -3'
(R):5'- GGCTGAAGTGTACAACTGAATTATTC -3'
Posted On2018-02-28