Incidental Mutation 'R6235:Sdk1'
ID504861
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142034426 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 913 (H913L)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: H653L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: H653L

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085774
AA Change: H913L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: H913L

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Meta Mutation Damage Score 0.3148 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense not run
Z1177:Sdk1 UTSW 5 141962708 missense not run
Predicted Primers PCR Primer
(F):5'- AATGGTATGACATTTATGGACTTACTG -3'
(R):5'- CATGACCTCCTCTTGTCAGTAG -3'

Sequencing Primer
(F):5'- AGGGGGTCTTTTTTGTAACC -3'
(R):5'- TCAGTAGTCCCTGAGAGGATAGCTC -3'
Posted On2018-02-28