Incidental Mutation 'R6235:Cnga4'
ID504872
Institutional Source Beutler Lab
Gene Symbol Cnga4
Ensembl Gene ENSMUSG00000030897
Gene Namecyclic nucleotide gated channel alpha 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105404568-105408742 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 105407699 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 336 (Y336*)
Ref Sequence ENSEMBL: ENSMUSP00000147387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033187] [ENSMUST00000210344]
Predicted Effect probably null
Transcript: ENSMUST00000033187
AA Change: Y439*
SMART Domains Protein: ENSMUSP00000033187
Gene: ENSMUSG00000030897
AA Change: Y439*

DomainStartEndE-ValueType
Pfam:Ion_trans 34 276 1.1e-28 PFAM
cNMP 348 472 1.54e-25 SMART
low complexity region 500 508 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210344
AA Change: Y336*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNGA4 is a modulatory subunit of vertebrate cyclic nucleotide-gated membrane channels that transduce odorant signals (Munger et al., 2001 [PubMed 11739959]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Inactivation of this gene results in odor adaptation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Cnga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cnga4 APN 7 105404962 missense probably benign
IGL01418:Cnga4 APN 7 105404962 missense probably benign
IGL02450:Cnga4 APN 7 105405748 missense probably damaging 1.00
IGL02533:Cnga4 APN 7 105407961 missense probably damaging 0.97
IGL03052:Cnga4 UTSW 7 105404725 missense probably benign 0.21
R0020:Cnga4 UTSW 7 105405677 missense probably damaging 1.00
R0135:Cnga4 UTSW 7 105406848 missense probably damaging 1.00
R0281:Cnga4 UTSW 7 105407668 missense probably damaging 1.00
R0506:Cnga4 UTSW 7 105407740 missense probably damaging 1.00
R0599:Cnga4 UTSW 7 105405818 missense probably damaging 1.00
R0646:Cnga4 UTSW 7 105404975 missense possibly damaging 0.47
R0980:Cnga4 UTSW 7 105408006 missense probably damaging 1.00
R1727:Cnga4 UTSW 7 105405754 missense probably damaging 1.00
R3415:Cnga4 UTSW 7 105407118 missense probably damaging 1.00
R3768:Cnga4 UTSW 7 105407680 missense probably damaging 1.00
R4559:Cnga4 UTSW 7 105405685 missense probably damaging 1.00
R4852:Cnga4 UTSW 7 105405730 missense probably benign 0.01
R5081:Cnga4 UTSW 7 105407025 missense probably benign 0.20
R6232:Cnga4 UTSW 7 105407699 nonsense probably null
R6234:Cnga4 UTSW 7 105407699 nonsense probably null
R6824:Cnga4 UTSW 7 105406829 missense probably benign
R6866:Cnga4 UTSW 7 105407745 missense possibly damaging 0.95
R6997:Cnga4 UTSW 7 105406983 missense probably damaging 1.00
R7019:Cnga4 UTSW 7 105405829 missense probably benign 0.00
R7273:Cnga4 UTSW 7 105406965 missense probably damaging 1.00
R7509:Cnga4 UTSW 7 105406890 missense probably benign 0.32
R7522:Cnga4 UTSW 7 105405988 missense probably damaging 0.99
R7545:Cnga4 UTSW 7 105407079 missense probably damaging 1.00
R7873:Cnga4 UTSW 7 105407042 missense probably damaging 0.99
R7956:Cnga4 UTSW 7 105407042 missense probably damaging 0.99
R8024:Cnga4 UTSW 7 105406835 missense probably damaging 1.00
X0025:Cnga4 UTSW 7 105405220 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGAAAAGTGGCTTGGC -3'
(R):5'- ACTTGGTCTGTAGGTCATCAAGC -3'

Sequencing Primer
(F):5'- CTCAGAAGCACCAATGTGGAG -3'
(R):5'- AGGTCATCAAGCTGCTGGTC -3'
Posted On2018-02-28