Mutagenetix > Incidental Mutations

Incidental Mutation 'R6235:Itk'

504885

Institutional Source

Beutler Lab

Gene Symbol

Itk

Ensembl Gene

ENSMUSG00000020395

Gene Name

IL2 inducible T cell kinase

Synonyms

Emt, Tsk, Tcsk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R6235 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46325150-46389515 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46336428 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 456 (E456G)

Ref Sequence

ENSEMBL: ENSMUSP00000020664 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000109237]

Predicted Effect

probably benign
Transcript: ENSMUST00000020664
AA Change: E456G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: E456G

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART
SH2	237	328	9.44e-29	SMART
TyrKc	362	611	3.28e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109237
AA Change: E462G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: E462G

Domain	Start	End	E-Value	Type
PH	5	119	3.94e-12	SMART
BTK	119	155	1.1e-21	SMART
SH3	180	236	5.87e-14	SMART
SH2	243	334	9.44e-29	SMART
TyrKc	368	617	3.28e-133	SMART

Meta Mutation Damage Score

0.0815

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	T	C	12: 113,491,710	F716L	probably benign	Het
Akip1	A	G	7: 109,707,413	M106V	probably benign	Het
Aldh1l1	A	T	6: 90,564,457	I278F	probably benign	Het
Aplnr	A	G	2: 85,137,626	T332A	probably benign	Het
Aqp4	A	G	18: 15,398,113	V197A	probably damaging	Het
Arid4a	A	T	12: 71,069,772		probably null	Het
Baiap2	A	T	11: 119,981,408	N99Y	probably damaging	Het
Ceacam1	A	T	7: 25,471,792		probably null	Het
Cep78	T	C	19: 15,976,486		probably null	Het
Cldn3	T	C	5: 134,986,719	F92S	possibly damaging	Het
Clec16a	C	A	16: 10,694,635	P812Q	probably damaging	Het
Cnga4	T	G	7: 105,407,699	Y336*	probably null	Het
Copg2	A	G	6: 30,816,071	I443T	probably damaging	Het
Crhbp	C	A	13: 95,443,850	A81S	probably damaging	Het
Csad	A	T	15: 102,178,606	V410D	probably damaging	Het
Ctps	G	A	4: 120,558,806	L207F	probably benign	Het
Dab2ip	A	G	2: 35,723,087	E1003G	probably damaging	Het
Ddx31	C	G	2: 28,844,842	A5G	probably benign	Het
Dnah12	A	T	14: 26,854,804	I3004F	probably damaging	Het
Fbxo15	A	G	18: 84,980,904		probably benign	Het
Fbxw28	C	A	9: 109,326,190	W356C	probably damaging	Het
Gimap6	G	T	6: 48,702,457	T215K	probably benign	Het
Gm5346	T	G	8: 43,625,912	N425T	probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Hunk	A	G	16: 90,432,706	I152V	probably damaging	Het
Krt40	G	A	11: 99,543,094	A22V	possibly damaging	Het
Lars2	T	C	9: 123,411,880	V204A	probably damaging	Het
Lipo1	A	G	19: 33,783,563	Y140H	probably damaging	Het
Lrp1	G	A	10: 127,588,177	R809W	probably damaging	Het
Magi3	C	T	3: 104,016,068	G1111D	probably damaging	Het
Mis18bp1	A	T	12: 65,158,408	V47E	probably damaging	Het
Mpdz	T	C	4: 81,385,281	E140G	probably damaging	Het
Myo1d	T	C	11: 80,692,944	I81V	probably benign	Het
Nek10	T	A	14: 14,821,113	Y26*	probably null	Het
Ntng2	C	A	2: 29,227,979	E152D	probably damaging	Het
Olfr1036	T	C	2: 86,075,166	L142P	possibly damaging	Het
Olfr1490	C	A	19: 13,654,781	C117*	probably null	Het
Otud3	A	T	4: 138,901,901	V185D	probably damaging	Het
Parp6	C	T	9: 59,630,815	R248W	probably benign	Het
Pcdhga7	A	G	18: 37,716,430	T497A	probably benign	Het
Ppp1r18	A	G	17: 35,873,877	E140G	probably damaging	Het
Prl3b1	T	C	13: 27,247,945	L151P	probably damaging	Het
Pth1r	C	T	9: 110,722,316	E572K	possibly damaging	Het
Ptprq	T	A	10: 107,635,338	T1401S	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,516	T480A	possibly damaging	Het
Rax	T	A	18: 65,935,161	Q291L	unknown	Het
Reck	T	C	4: 43,937,450	L734P	probably damaging	Het
Rgmb	A	G	17: 15,820,819	F169L	probably damaging	Het
Rhobtb3	T	C	13: 75,892,910	I426M	probably damaging	Het
Ring1	C	A	17: 34,023,306	A76S	probably damaging	Het
Robo3	T	G	9: 37,420,929	Y891S	probably damaging	Het
Rpusd2	A	G	2: 119,034,857	I12V	probably benign	Het
Rragd	T	C	4: 32,995,985	V165A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Ryr1	G	T	7: 29,116,181	Q95K	probably benign	Het
S1pr4	T	A	10: 81,498,882	N253Y	possibly damaging	Het
Scn3a	A	C	2: 65,461,335	V1689G	probably damaging	Het
Sdhb	A	G	4: 140,973,673	N147D	probably damaging	Het
Sdk1	A	T	5: 142,034,426	H913L	possibly damaging	Het
Serpina3i	T	A	12: 104,266,532	M232K	probably damaging	Het
Sipa1l2	A	T	8: 125,474,871	V646E	probably damaging	Het
Slc38a1	A	T	15: 96,578,792	I396N	probably benign	Het
Slc6a13	A	T	6: 121,302,794	E42D	probably benign	Het
Stard9	G	A	2: 120,713,546	V4442M	probably damaging	Het
Sumo3	T	A	10: 77,616,237		probably benign	Het
Syngap1	A	G	17: 26,958,130	I356V	probably benign	Het
Tcam1	C	T	11: 106,284,054	Q112*	probably null	Het
Tdp2	T	A	13: 24,840,395	L225*	probably null	Het
Tmprss7	A	G	16: 45,658,122	V747A	probably benign	Het
Ugt2b34	T	A	5: 86,906,364	Y186F	probably benign	Het
Usp37	G	T	1: 74,475,133	S293*	probably null	Het
Vmn1r36	A	G	6: 66,716,246	I109T	probably benign	Het
Vsig10l	T	A	7: 43,468,972	V798E	probably benign	Het
Zfp36l1	G	T	12: 80,112,822	C18*	probably null	Het
Zfp959	T	C	17: 55,897,427	Y152H	probably damaging	Het
Zfyve26	A	T	12: 79,249,599	C1949S	probably damaging	Het
Zswim9	T	A	7: 13,261,603	E209V	probably damaging	Het

Other mutations in Itk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Itk	APN	11	46367896	missense	probably damaging	1.00
IGL01349:Itk	APN	11	46341200	missense	possibly damaging	0.84
IGL03290:Itk	APN	11	46334937	missense	probably damaging	1.00
IGL03385:Itk	APN	11	46331861	nonsense	probably null
Calame	UTSW	11	46342395	splice site	probably null
carbone	UTSW	11	46331949	nonsense	probably null
goodnow	UTSW	11	46338099	splice site	probably null
itxaro	UTSW	11	46338217	missense	probably damaging	1.00
BB009:Itk	UTSW	11	46340692	missense	probably benign
BB019:Itk	UTSW	11	46340692	missense	probably benign
R0095:Itk	UTSW	11	46342452	missense	probably damaging	0.99
R0265:Itk	UTSW	11	46389458	start gained	probably benign
R0281:Itk	UTSW	11	46353916	missense	probably damaging	1.00
R0463:Itk	UTSW	11	46331989	missense	probably damaging	1.00
R0518:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R0521:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R1121:Itk	UTSW	11	46331894	missense	possibly damaging	0.93
R1550:Itk	UTSW	11	46389326	missense	probably damaging	1.00
R1762:Itk	UTSW	11	46336482	missense	probably damaging	0.98
R2418:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2419:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2859:Itk	UTSW	11	46344835	intron	probably benign
R3107:Itk	UTSW	11	46327464	missense	probably benign	0.15
R3546:Itk	UTSW	11	46355848	missense	probably benign	0.00
R4601:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4610:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4792:Itk	UTSW	11	46344831	intron	probably benign
R4885:Itk	UTSW	11	46336344	splice site	probably null
R4934:Itk	UTSW	11	46389325	missense	probably damaging	1.00
R5286:Itk	UTSW	11	46338099	splice site	probably null
R5328:Itk	UTSW	11	46331876	missense	probably benign	0.04
R5399:Itk	UTSW	11	46338111	missense	probably benign	0.44
R5958:Itk	UTSW	11	46344855	intron	probably benign
R6828:Itk	UTSW	11	46341218	missense	probably damaging	1.00
R6849:Itk	UTSW	11	46331935	missense	probably damaging	1.00
R7356:Itk	UTSW	11	46367832	missense	possibly damaging	0.72
R7753:Itk	UTSW	11	46331895	missense	probably damaging	1.00
R7932:Itk	UTSW	11	46340692	missense	probably benign
R7988:Itk	UTSW	11	46355834	missense	probably damaging	0.99
R8188:Itk	UTSW	11	46331949	nonsense	probably null
R8337:Itk	UTSW	11	46342395	splice site	probably null
U24488:Itk	UTSW	11	46338144	missense	probably damaging	1.00
X0062:Itk	UTSW	11	46366044	missense	probably benign	0.15
Z1088:Itk	UTSW	11	46353862	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTCTCTCAGACTTGGCAG -3'
(R):5'- AAGTGCCTCTCATCTACCTCAGTG -3'

Sequencing Primer
(F):5'- TTGGCAGAGCTACACTTCAG -3'
(R):5'- CCATCTTATGGTCAGCACTTTTAG -3'

Posted On

2018-02-28