Incidental Mutation 'R6235:Rad51ap2'
ID 504891
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 044433-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6235 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11507517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 480 (T480A)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect possibly damaging
Transcript: ENSMUST00000124065
AA Change: T480A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: T480A

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l T G 8: 44,078,949 (GRCm39) N425T probably benign Het
Adam6b T C 12: 113,455,330 (GRCm39) F716L probably benign Het
Akip1 A G 7: 109,306,620 (GRCm39) M106V probably benign Het
Aldh1l1 A T 6: 90,541,439 (GRCm39) I278F probably benign Het
Aplnr A G 2: 84,967,970 (GRCm39) T332A probably benign Het
Aqp4 A G 18: 15,531,170 (GRCm39) V197A probably damaging Het
Arid4a A T 12: 71,116,546 (GRCm39) probably null Het
Baiap2 A T 11: 119,872,234 (GRCm39) N99Y probably damaging Het
Ceacam1 A T 7: 25,171,217 (GRCm39) probably null Het
Cep78 T C 19: 15,953,850 (GRCm39) probably null Het
Cldn3 T C 5: 135,015,573 (GRCm39) F92S possibly damaging Het
Clec16a C A 16: 10,512,499 (GRCm39) P812Q probably damaging Het
Cnga4 T G 7: 105,056,906 (GRCm39) Y336* probably null Het
Copg2 A G 6: 30,793,006 (GRCm39) I443T probably damaging Het
Crhbp C A 13: 95,580,358 (GRCm39) A81S probably damaging Het
Csad A T 15: 102,087,041 (GRCm39) V410D probably damaging Het
Ctps1 G A 4: 120,416,003 (GRCm39) L207F probably benign Het
Dab2ip A G 2: 35,613,099 (GRCm39) E1003G probably damaging Het
Ddx31 C G 2: 28,734,854 (GRCm39) A5G probably benign Het
Dnah12 A T 14: 26,576,761 (GRCm39) I3004F probably damaging Het
Fbxo15 A G 18: 84,999,029 (GRCm39) probably benign Het
Fbxw28 C A 9: 109,155,258 (GRCm39) W356C probably damaging Het
Gimap6 G T 6: 48,679,391 (GRCm39) T215K probably benign Het
Hspa4 C T 11: 53,153,766 (GRCm39) E702K probably benign Het
Hunk A G 16: 90,229,594 (GRCm39) I152V probably damaging Het
Itk T C 11: 46,227,255 (GRCm39) E456G probably benign Het
Krt40 G A 11: 99,433,920 (GRCm39) A22V possibly damaging Het
Lars2 T C 9: 123,240,945 (GRCm39) V204A probably damaging Het
Lipo3 A G 19: 33,760,963 (GRCm39) Y140H probably damaging Het
Lrp1 G A 10: 127,424,046 (GRCm39) R809W probably damaging Het
Magi3 C T 3: 103,923,384 (GRCm39) G1111D probably damaging Het
Mis18bp1 A T 12: 65,205,182 (GRCm39) V47E probably damaging Het
Mpdz T C 4: 81,303,518 (GRCm39) E140G probably damaging Het
Myo1d T C 11: 80,583,770 (GRCm39) I81V probably benign Het
Nek10 T A 14: 14,821,113 (GRCm38) Y26* probably null Het
Ntng2 C A 2: 29,117,991 (GRCm39) E152D probably damaging Het
Or10w1 C A 19: 13,632,145 (GRCm39) C117* probably null Het
Or5m9b T C 2: 85,905,510 (GRCm39) L142P possibly damaging Het
Otud3 A T 4: 138,629,212 (GRCm39) V185D probably damaging Het
Parp6 C T 9: 59,538,098 (GRCm39) R248W probably benign Het
Pcdhga7 A G 18: 37,849,483 (GRCm39) T497A probably benign Het
Ppp1r18 A G 17: 36,184,769 (GRCm39) E140G probably damaging Het
Prl3b1 T C 13: 27,431,928 (GRCm39) L151P probably damaging Het
Pth1r C T 9: 110,551,384 (GRCm39) E572K possibly damaging Het
Ptprq T A 10: 107,471,199 (GRCm39) T1401S possibly damaging Het
Rax T A 18: 66,068,232 (GRCm39) Q291L unknown Het
Reck T C 4: 43,937,450 (GRCm39) L734P probably damaging Het
Rgmb A G 17: 16,041,081 (GRCm39) F169L probably damaging Het
Rhobtb3 T C 13: 76,041,029 (GRCm39) I426M probably damaging Het
Ring1 C A 17: 34,242,280 (GRCm39) A76S probably damaging Het
Robo3 T G 9: 37,332,225 (GRCm39) Y891S probably damaging Het
Rpusd2 A G 2: 118,865,338 (GRCm39) I12V probably benign Het
Rragd T C 4: 32,995,985 (GRCm39) V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Homo
Ryr1 G T 7: 28,815,606 (GRCm39) Q95K probably benign Het
S1pr4 T A 10: 81,334,716 (GRCm39) N253Y possibly damaging Het
Scn3a A C 2: 65,291,679 (GRCm39) V1689G probably damaging Het
Sdhb A G 4: 140,700,984 (GRCm39) N147D probably damaging Het
Sdk1 A T 5: 142,020,181 (GRCm39) H913L possibly damaging Het
Serpina3i T A 12: 104,232,791 (GRCm39) M232K probably damaging Het
Sipa1l2 A T 8: 126,201,610 (GRCm39) V646E probably damaging Het
Slc38a1 A T 15: 96,476,673 (GRCm39) I396N probably benign Het
Slc6a13 A T 6: 121,279,753 (GRCm39) E42D probably benign Het
Stard9 G A 2: 120,544,027 (GRCm39) V4442M probably damaging Het
Sumo3 T A 10: 77,452,071 (GRCm39) probably benign Het
Syngap1 A G 17: 27,177,104 (GRCm39) I356V probably benign Het
Tcam1 C T 11: 106,174,880 (GRCm39) Q112* probably null Het
Tdp2 T A 13: 25,024,378 (GRCm39) L225* probably null Het
Tmprss7 A G 16: 45,478,485 (GRCm39) V747A probably benign Het
Ugt2b34 T A 5: 87,054,223 (GRCm39) Y186F probably benign Het
Usp37 G T 1: 74,514,292 (GRCm39) S293* probably null Het
Vmn1r36 A G 6: 66,693,230 (GRCm39) I109T probably benign Het
Vsig10l T A 7: 43,118,396 (GRCm39) V798E probably benign Het
Zfp36l1 G T 12: 80,159,596 (GRCm39) C18* probably null Het
Zfp959 T C 17: 56,204,427 (GRCm39) Y152H probably damaging Het
Zfyve26 A T 12: 79,296,373 (GRCm39) C1949S probably damaging Het
Zswim9 T A 7: 12,995,529 (GRCm39) E209V probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGGACTGTGACAGATCTATTTTG -3'
(R):5'- GTAGTTTGGCACATCTTGTACTCTC -3'

Sequencing Primer
(F):5'- GAAGAGGGATGCATTTTCA -3'
(R):5'- GGCACATCTTGTACTCTCATAACTAG -3'
Posted On 2018-02-28