Mutagenetix > Incidental Mutations

Incidental Mutation 'R6235:Arid4a'

504893

Institutional Source

Beutler Lab

Gene Symbol

Arid4a

Ensembl Gene

ENSMUSG00000048118

Gene Name

AT rich interactive domain 4A (RBP1-like)

Synonyms

Rbbp1, A630067N03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6235 (G1)

Quality Score

107.008

Status

Not validated

Chromosome

Chromosomal Location

71015990-71098592 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 71069772 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]

Predicted Effect

probably null
Transcript: ENSMUST00000046305

SMART Domains

Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	3.6e-12	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	170	262	4e-32	PFAM
ARID	306	397	6.7e-37	SMART
BRIGHT	310	402	2.3e-40	SMART
low complexity region	411	422	N/A	INTRINSIC
CHROMO	483	652	6.8e-6	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	965	976	N/A	INTRINSIC
low complexity region	991	1003	N/A	INTRINSIC
coiled coil region	1185	1224	N/A	INTRINSIC
low complexity region	1229	1252	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134718

Predicted Effect

probably null
Transcript: ENSMUST00000135709

SMART Domains

Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118

Domain	Start	End	E-Value	Type
ARID	1	75	1.02e-16	SMART
BRIGHT	1	80	2.05e-23	SMART
low complexity region	89	100	N/A	INTRINSIC
CHROMO	161	330	1.08e-3	SMART
low complexity region	368	385	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	T	C	12: 113,491,710	F716L	probably benign	Het
Akip1	A	G	7: 109,707,413	M106V	probably benign	Het
Aldh1l1	A	T	6: 90,564,457	I278F	probably benign	Het
Aplnr	A	G	2: 85,137,626	T332A	probably benign	Het
Aqp4	A	G	18: 15,398,113	V197A	probably damaging	Het
Baiap2	A	T	11: 119,981,408	N99Y	probably damaging	Het
Ceacam1	A	T	7: 25,471,792		probably null	Het
Cep78	T	C	19: 15,976,486		probably null	Het
Cldn3	T	C	5: 134,986,719	F92S	possibly damaging	Het
Clec16a	C	A	16: 10,694,635	P812Q	probably damaging	Het
Cnga4	T	G	7: 105,407,699	Y336*	probably null	Het
Copg2	A	G	6: 30,816,071	I443T	probably damaging	Het
Crhbp	C	A	13: 95,443,850	A81S	probably damaging	Het
Csad	A	T	15: 102,178,606	V410D	probably damaging	Het
Ctps	G	A	4: 120,558,806	L207F	probably benign	Het
Dab2ip	A	G	2: 35,723,087	E1003G	probably damaging	Het
Ddx31	C	G	2: 28,844,842	A5G	probably benign	Het
Dnah12	A	T	14: 26,854,804	I3004F	probably damaging	Het
Fbxo15	A	G	18: 84,980,904		probably benign	Het
Fbxw28	C	A	9: 109,326,190	W356C	probably damaging	Het
Gimap6	G	T	6: 48,702,457	T215K	probably benign	Het
Gm5346	T	G	8: 43,625,912	N425T	probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Hunk	A	G	16: 90,432,706	I152V	probably damaging	Het
Itk	T	C	11: 46,336,428	E456G	probably benign	Het
Krt40	G	A	11: 99,543,094	A22V	possibly damaging	Het
Lars2	T	C	9: 123,411,880	V204A	probably damaging	Het
Lipo1	A	G	19: 33,783,563	Y140H	probably damaging	Het
Lrp1	G	A	10: 127,588,177	R809W	probably damaging	Het
Magi3	C	T	3: 104,016,068	G1111D	probably damaging	Het
Mis18bp1	A	T	12: 65,158,408	V47E	probably damaging	Het
Mpdz	T	C	4: 81,385,281	E140G	probably damaging	Het
Myo1d	T	C	11: 80,692,944	I81V	probably benign	Het
Nek10	T	A	14: 14,821,113	Y26*	probably null	Het
Ntng2	C	A	2: 29,227,979	E152D	probably damaging	Het
Olfr1036	T	C	2: 86,075,166	L142P	possibly damaging	Het
Olfr1490	C	A	19: 13,654,781	C117*	probably null	Het
Otud3	A	T	4: 138,901,901	V185D	probably damaging	Het
Parp6	C	T	9: 59,630,815	R248W	probably benign	Het
Pcdhga7	A	G	18: 37,716,430	T497A	probably benign	Het
Ppp1r18	A	G	17: 35,873,877	E140G	probably damaging	Het
Prl3b1	T	C	13: 27,247,945	L151P	probably damaging	Het
Pth1r	C	T	9: 110,722,316	E572K	possibly damaging	Het
Ptprq	T	A	10: 107,635,338	T1401S	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,516	T480A	possibly damaging	Het
Rax	T	A	18: 65,935,161	Q291L	unknown	Het
Reck	T	C	4: 43,937,450	L734P	probably damaging	Het
Rgmb	A	G	17: 15,820,819	F169L	probably damaging	Het
Rhobtb3	T	C	13: 75,892,910	I426M	probably damaging	Het
Ring1	C	A	17: 34,023,306	A76S	probably damaging	Het
Robo3	T	G	9: 37,420,929	Y891S	probably damaging	Het
Rpusd2	A	G	2: 119,034,857	I12V	probably benign	Het
Rragd	T	C	4: 32,995,985	V165A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Ryr1	G	T	7: 29,116,181	Q95K	probably benign	Het
S1pr4	T	A	10: 81,498,882	N253Y	possibly damaging	Het
Scn3a	A	C	2: 65,461,335	V1689G	probably damaging	Het
Sdhb	A	G	4: 140,973,673	N147D	probably damaging	Het
Sdk1	A	T	5: 142,034,426	H913L	possibly damaging	Het
Serpina3i	T	A	12: 104,266,532	M232K	probably damaging	Het
Sipa1l2	A	T	8: 125,474,871	V646E	probably damaging	Het
Slc38a1	A	T	15: 96,578,792	I396N	probably benign	Het
Slc6a13	A	T	6: 121,302,794	E42D	probably benign	Het
Stard9	G	A	2: 120,713,546	V4442M	probably damaging	Het
Sumo3	T	A	10: 77,616,237		probably benign	Het
Syngap1	A	G	17: 26,958,130	I356V	probably benign	Het
Tcam1	C	T	11: 106,284,054	Q112*	probably null	Het
Tdp2	T	A	13: 24,840,395	L225*	probably null	Het
Tmprss7	A	G	16: 45,658,122	V747A	probably benign	Het
Ugt2b34	T	A	5: 86,906,364	Y186F	probably benign	Het
Usp37	G	T	1: 74,475,133	S293*	probably null	Het
Vmn1r36	A	G	6: 66,716,246	I109T	probably benign	Het
Vsig10l	T	A	7: 43,468,972	V798E	probably benign	Het
Zfp36l1	G	T	12: 80,112,822	C18*	probably null	Het
Zfp959	T	C	17: 55,897,427	Y152H	probably damaging	Het
Zfyve26	A	T	12: 79,249,599	C1949S	probably damaging	Het
Zswim9	T	A	7: 13,261,603	E209V	probably damaging	Het

Other mutations in Arid4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Arid4a	APN	12	71072593	missense	probably damaging	1.00
IGL00546:Arid4a	APN	12	71075671	missense	probably benign
IGL00553:Arid4a	APN	12	71075977	missense	probably benign	0.04
IGL00708:Arid4a	APN	12	71072728	missense	probably benign	0.02
IGL00847:Arid4a	APN	12	71075718	missense	probably damaging	1.00
IGL01112:Arid4a	APN	12	71072733	critical splice donor site	probably null
IGL01456:Arid4a	APN	12	71067262	missense	probably benign	0.00
IGL01505:Arid4a	APN	12	71037115	missense	probably damaging	1.00
IGL01555:Arid4a	APN	12	71061527	splice site	probably benign
IGL01631:Arid4a	APN	12	71022262	splice site	probably benign
IGL02958:Arid4a	APN	12	71097563	missense	probably benign	0.01
IGL03087:Arid4a	APN	12	71075245	missense	possibly damaging	0.94
IGL03111:Arid4a	APN	12	71039966	missense	probably damaging	1.00
IGL03234:Arid4a	APN	12	71045060	missense	probably benign	0.34
After_8	UTSW	12	71023498	critical splice acceptor site	probably null
ariano	UTSW	12	71069860	nonsense	probably null
guava	UTSW	12	71072632	missense	probably damaging	0.99
limoncello	UTSW	12	71067341	splice site	probably null
Under_8	UTSW	12	71063206	missense	probably benign	0.10
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0270:Arid4a	UTSW	12	71072632	missense	probably damaging	0.99
R0310:Arid4a	UTSW	12	71075830	missense	probably benign	0.05
R0504:Arid4a	UTSW	12	71047214	missense	probably damaging	1.00
R1061:Arid4a	UTSW	12	71074955	missense	probably damaging	1.00
R1087:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1169:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1171:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1531:Arid4a	UTSW	12	71076005	missense	probably benign	0.01
R1674:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1676:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1768:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1833:Arid4a	UTSW	12	71075466	missense	possibly damaging	0.50
R1878:Arid4a	UTSW	12	71087589	missense	probably damaging	1.00
R2290:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2292:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R3411:Arid4a	UTSW	12	71061525	splice site	probably benign
R3768:Arid4a	UTSW	12	71067119	missense	probably damaging	1.00
R3838:Arid4a	UTSW	12	71075785	missense	possibly damaging	0.94
R4320:Arid4a	UTSW	12	71069995	missense	possibly damaging	0.69
R4589:Arid4a	UTSW	12	71069964	missense	probably damaging	1.00
R4829:Arid4a	UTSW	12	71023498	critical splice acceptor site	probably null
R4862:Arid4a	UTSW	12	71075947	missense	probably damaging	0.96
R4952:Arid4a	UTSW	12	71023525	missense	possibly damaging	0.64
R5072:Arid4a	UTSW	12	71045079	missense	probably benign	0.08
R5423:Arid4a	UTSW	12	71069860	nonsense	probably null
R5767:Arid4a	UTSW	12	71060093	missense	probably damaging	1.00
R5911:Arid4a	UTSW	12	71069973	missense	probably damaging	1.00
R5952:Arid4a	UTSW	12	71063206	missense	probably benign	0.10
R6088:Arid4a	UTSW	12	71022236	missense	probably damaging	0.99
R6277:Arid4a	UTSW	12	71039891	missense	possibly damaging	0.49
R6455:Arid4a	UTSW	12	71075088	missense	probably benign	0.04
R6523:Arid4a	UTSW	12	71067341	splice site	probably null
R6701:Arid4a	UTSW	12	71087512	missense	probably damaging	1.00
R6812:Arid4a	UTSW	12	71047263	missense	possibly damaging	0.92
R6815:Arid4a	UTSW	12	71017082	splice site	probably null
R6837:Arid4a	UTSW	12	71075515	missense	probably benign
R6858:Arid4a	UTSW	12	71023509	missense	probably benign	0.01
R6895:Arid4a	UTSW	12	71063302	missense	probably benign	0.18
R6901:Arid4a	UTSW	12	71067137	missense	probably damaging	0.99
R6905:Arid4a	UTSW	12	71061544	missense	probably benign	0.43
R7387:Arid4a	UTSW	12	71087496	missense	probably damaging	1.00
R7570:Arid4a	UTSW	12	71063142	nonsense	probably null
R7772:Arid4a	UTSW	12	71061589	missense	possibly damaging	0.65
Z1176:Arid4a	UTSW	12	71039920	missense	possibly damaging	0.89
Z1177:Arid4a	UTSW	12	71075637	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGCCTTTAAGAAGAATGGGTTTACC -3'
(R):5'- TACAGAATCTCCCCGTCGTC -3'

Sequencing Primer
(F):5'- AAGAAGAATGGGTTTACCTTTGTG -3'
(R):5'- GATGCTGGCTTCATAAATTTTCTGAG -3'

Posted On

2018-02-28