Incidental Mutation 'R6235:Rgmb'
ID504909
Institutional Source Beutler Lab
Gene Symbol Rgmb
Ensembl Gene ENSMUSG00000048027
Gene Namerepulsive guidance molecule family member B
SynonymsDRAGON, 1110059F19Rik, RGM domain family, member B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15803188-15831039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15820819 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 169 (F169L)
Ref Sequence ENSEMBL: ENSMUSP00000126177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170578] [ENSMUST00000231281] [ENSMUST00000232638]
Predicted Effect probably damaging
Transcript: ENSMUST00000170578
AA Change: F169L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126177
Gene: ENSMUSG00000048027
AA Change: F169L

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
Pfam:RGM_N 57 225 6.8e-66 PFAM
Pfam:RGM_C 229 408 1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232592
Predicted Effect possibly damaging
Transcript: ENSMUST00000232638
AA Change: F169L

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.9369 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RGMB is a glycosylphosphatidylinositol (GPI)-anchored member of the repulsive guidance molecule family (see RGMA, MIM 607362) and contributes to the patterning of the developing nervous system (Samad et al., 2005 [PubMed 15671031]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality at 2 to 3 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Rgmb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Rgmb APN 17 15807493 missense probably benign 0.00
IGL03338:Rgmb APN 17 15807303 missense possibly damaging 0.90
R2504:Rgmb UTSW 17 15807647 missense probably benign 0.00
R2991:Rgmb UTSW 17 15821090 missense probably damaging 0.97
R4460:Rgmb UTSW 17 15807626 missense probably benign 0.00
R4835:Rgmb UTSW 17 15807362 missense possibly damaging 0.93
R5304:Rgmb UTSW 17 15820728 nonsense probably null
R6950:Rgmb UTSW 17 15807786 missense probably damaging 1.00
R7543:Rgmb UTSW 17 15807515 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCTGAAGGACCGAACAAC -3'
(R):5'- ACCTGGTGTACCATTCTGC -3'

Sequencing Primer
(F):5'- TCTGAAGGACCGAACAACTTGAATG -3'
(R):5'- CCATTCTGCTGTGTTAGGCATCAG -3'
Posted On2018-02-28