Incidental Mutation 'R6235:Syngap1'
ID504910
Institutional Source Beutler Lab
Gene Symbol Syngap1
Ensembl Gene ENSMUSG00000067629
Gene Namesynaptic Ras GTPase activating protein 1 homolog (rat)
SynonymsSyngap
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26941253-26972434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26958130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 356 (I356V)
Ref Sequence ENSEMBL: ENSMUSP00000156340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081285] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000202939] [ENSMUST00000228963] [ENSMUST00000229490] [ENSMUST00000231853]
Predicted Effect probably benign
Transcript: ENSMUST00000081285
AA Change: I470V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080038
Gene: ENSMUSG00000067629
AA Change: I470V

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177932
AA Change: I529V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629
AA Change: I529V

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193200
AA Change: I513V
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629
AA Change: I513V

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
AA Change: I529V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629
AA Change: I529V

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200799
Predicted Effect probably benign
Transcript: ENSMUST00000201186
Predicted Effect unknown
Transcript: ENSMUST00000201349
AA Change: I528V
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629
AA Change: I528V

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201702
AA Change: I529V
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629
AA Change: I529V

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202049
Predicted Effect probably benign
Transcript: ENSMUST00000202208
Predicted Effect probably benign
Transcript: ENSMUST00000202939
AA Change: I36V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144403
Gene: ENSMUSG00000067629
AA Change: I36V

DomainStartEndE-ValueType
Pfam:RasGAP 1 61 5.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228963
AA Change: I470V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000229490
AA Change: I529V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000231853
AA Change: I356V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Homozygous null mutations result in early post-embryonic lethality, while heterozygous mutant mice display a variety of phenotypes that include learning and memory defects, hyperactivity, and audiogenic seizures. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, and by P3-P4, exhibit small body size and brain, reduced movement and do not feed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Ring1 C A 17: 34,023,306 A76S probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Syngap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0732:Syngap1 UTSW 17 26954988 missense possibly damaging 0.94
R1178:Syngap1 UTSW 17 26957805 missense probably damaging 0.99
R1680:Syngap1 UTSW 17 26952579 missense possibly damaging 0.60
R1953:Syngap1 UTSW 17 26944687 missense possibly damaging 0.94
R2213:Syngap1 UTSW 17 26953069 missense probably damaging 1.00
R2696:Syngap1 UTSW 17 26957411 nonsense probably null
R2899:Syngap1 UTSW 17 26959985 missense probably damaging 1.00
R3237:Syngap1 UTSW 17 26957093 nonsense probably null
R3705:Syngap1 UTSW 17 26960020 missense probably damaging 1.00
R3880:Syngap1 UTSW 17 26953064 missense probably damaging 1.00
R4019:Syngap1 UTSW 17 26952341 unclassified probably benign
R4661:Syngap1 UTSW 17 26966906 missense probably damaging 1.00
R4798:Syngap1 UTSW 17 26961449 missense probably benign 0.00
R5524:Syngap1 UTSW 17 26957152 missense probably damaging 1.00
R5580:Syngap1 UTSW 17 26962331 missense probably damaging 0.97
R5610:Syngap1 UTSW 17 26959780 missense possibly damaging 0.68
R5835:Syngap1 UTSW 17 26958218 missense probably benign 0.09
R5974:Syngap1 UTSW 17 26963038 missense probably damaging 0.98
R6247:Syngap1 UTSW 17 26962957 nonsense probably null
R6461:Syngap1 UTSW 17 26964848 missense probably damaging 1.00
R6503:Syngap1 UTSW 17 26944684 missense probably benign 0.40
R7134:Syngap1 UTSW 17 26960011 missense probably damaging 1.00
R7248:Syngap1 UTSW 17 26957767 missense probably damaging 1.00
R7298:Syngap1 UTSW 17 26962987 missense possibly damaging 0.85
R7749:Syngap1 UTSW 17 26959964 missense probably damaging 0.99
R7812:Syngap1 UTSW 17 26941504 missense probably benign
R7864:Syngap1 UTSW 17 26970528 missense
R7947:Syngap1 UTSW 17 26970528 missense
R7966:Syngap1 UTSW 17 26961477 small deletion probably benign
R8024:Syngap1 UTSW 17 26941452 start codon destroyed probably benign 0.01
X0017:Syngap1 UTSW 17 26944651 missense probably benign 0.11
Z1088:Syngap1 UTSW 17 26961576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCATTGGTACTTCAGGCC -3'
(R):5'- TCCTCTGAGGATGGACAGATGG -3'

Sequencing Primer
(F):5'- ATATCCACCTTCCTCAGAGTCCCAG -3'
(R):5'- TGGATGAACAGATGAACACACAACTG -3'
Posted On2018-02-28