Incidental Mutation 'R6235:Ring1'
ID 504911
Institutional Source Beutler Lab
Gene Symbol Ring1
Ensembl Gene ENSMUSG00000024325
Gene Name ring finger protein 1
Synonyms Ring1A
MMRRC Submission 044433-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.723) question?
Stock # R6235 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34239766-34243654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34242280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 76 (A76S)
Ref Sequence ENSEMBL: ENSMUSP00000025183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000025186] [ENSMUST00000045467] [ENSMUST00000114303] [ENSMUST00000169397]
AlphaFold O35730
Predicted Effect probably damaging
Transcript: ENSMUST00000025183
AA Change: A76S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325
AA Change: A76S

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025186
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083621
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170644
Predicted Effect probably benign
Transcript: ENSMUST00000169397
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173425
Meta Mutation Damage Score 0.4634 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RING finger family, members of which encode proteins characterized by a RING domain, a zinc-binding motif related to the zinc finger domain. The gene product can bind DNA and can act as a transcriptional repressor. It is associated with the multimeric polycomb group protein complex. The gene product interacts with the polycomb group proteins BMI1, EDR1, and CBX4, and colocalizes with these proteins in large nuclear domains. It interacts with the CBX4 protein via its glycine-rich C-terminal domain. The gene maps to the HLA class II region, where it is contiguous with the RING finger genes FABGL and HKE4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygous and heterozygous mutant mice show axial skeleton defects including anterior transformations of vertebrae and rib abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l T G 8: 44,078,949 (GRCm39) N425T probably benign Het
Adam6b T C 12: 113,455,330 (GRCm39) F716L probably benign Het
Akip1 A G 7: 109,306,620 (GRCm39) M106V probably benign Het
Aldh1l1 A T 6: 90,541,439 (GRCm39) I278F probably benign Het
Aplnr A G 2: 84,967,970 (GRCm39) T332A probably benign Het
Aqp4 A G 18: 15,531,170 (GRCm39) V197A probably damaging Het
Arid4a A T 12: 71,116,546 (GRCm39) probably null Het
Baiap2 A T 11: 119,872,234 (GRCm39) N99Y probably damaging Het
Ceacam1 A T 7: 25,171,217 (GRCm39) probably null Het
Cep78 T C 19: 15,953,850 (GRCm39) probably null Het
Cldn3 T C 5: 135,015,573 (GRCm39) F92S possibly damaging Het
Clec16a C A 16: 10,512,499 (GRCm39) P812Q probably damaging Het
Cnga4 T G 7: 105,056,906 (GRCm39) Y336* probably null Het
Copg2 A G 6: 30,793,006 (GRCm39) I443T probably damaging Het
Crhbp C A 13: 95,580,358 (GRCm39) A81S probably damaging Het
Csad A T 15: 102,087,041 (GRCm39) V410D probably damaging Het
Ctps1 G A 4: 120,416,003 (GRCm39) L207F probably benign Het
Dab2ip A G 2: 35,613,099 (GRCm39) E1003G probably damaging Het
Ddx31 C G 2: 28,734,854 (GRCm39) A5G probably benign Het
Dnah12 A T 14: 26,576,761 (GRCm39) I3004F probably damaging Het
Fbxo15 A G 18: 84,999,029 (GRCm39) probably benign Het
Fbxw28 C A 9: 109,155,258 (GRCm39) W356C probably damaging Het
Gimap6 G T 6: 48,679,391 (GRCm39) T215K probably benign Het
Hspa4 C T 11: 53,153,766 (GRCm39) E702K probably benign Het
Hunk A G 16: 90,229,594 (GRCm39) I152V probably damaging Het
Itk T C 11: 46,227,255 (GRCm39) E456G probably benign Het
Krt40 G A 11: 99,433,920 (GRCm39) A22V possibly damaging Het
Lars2 T C 9: 123,240,945 (GRCm39) V204A probably damaging Het
Lipo3 A G 19: 33,760,963 (GRCm39) Y140H probably damaging Het
Lrp1 G A 10: 127,424,046 (GRCm39) R809W probably damaging Het
Magi3 C T 3: 103,923,384 (GRCm39) G1111D probably damaging Het
Mis18bp1 A T 12: 65,205,182 (GRCm39) V47E probably damaging Het
Mpdz T C 4: 81,303,518 (GRCm39) E140G probably damaging Het
Myo1d T C 11: 80,583,770 (GRCm39) I81V probably benign Het
Nek10 T A 14: 14,821,113 (GRCm38) Y26* probably null Het
Ntng2 C A 2: 29,117,991 (GRCm39) E152D probably damaging Het
Or10w1 C A 19: 13,632,145 (GRCm39) C117* probably null Het
Or5m9b T C 2: 85,905,510 (GRCm39) L142P possibly damaging Het
Otud3 A T 4: 138,629,212 (GRCm39) V185D probably damaging Het
Parp6 C T 9: 59,538,098 (GRCm39) R248W probably benign Het
Pcdhga7 A G 18: 37,849,483 (GRCm39) T497A probably benign Het
Ppp1r18 A G 17: 36,184,769 (GRCm39) E140G probably damaging Het
Prl3b1 T C 13: 27,431,928 (GRCm39) L151P probably damaging Het
Pth1r C T 9: 110,551,384 (GRCm39) E572K possibly damaging Het
Ptprq T A 10: 107,471,199 (GRCm39) T1401S possibly damaging Het
Rad51ap2 A G 12: 11,507,517 (GRCm39) T480A possibly damaging Het
Rax T A 18: 66,068,232 (GRCm39) Q291L unknown Het
Reck T C 4: 43,937,450 (GRCm39) L734P probably damaging Het
Rgmb A G 17: 16,041,081 (GRCm39) F169L probably damaging Het
Rhobtb3 T C 13: 76,041,029 (GRCm39) I426M probably damaging Het
Robo3 T G 9: 37,332,225 (GRCm39) Y891S probably damaging Het
Rpusd2 A G 2: 118,865,338 (GRCm39) I12V probably benign Het
Rragd T C 4: 32,995,985 (GRCm39) V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Homo
Ryr1 G T 7: 28,815,606 (GRCm39) Q95K probably benign Het
S1pr4 T A 10: 81,334,716 (GRCm39) N253Y possibly damaging Het
Scn3a A C 2: 65,291,679 (GRCm39) V1689G probably damaging Het
Sdhb A G 4: 140,700,984 (GRCm39) N147D probably damaging Het
Sdk1 A T 5: 142,020,181 (GRCm39) H913L possibly damaging Het
Serpina3i T A 12: 104,232,791 (GRCm39) M232K probably damaging Het
Sipa1l2 A T 8: 126,201,610 (GRCm39) V646E probably damaging Het
Slc38a1 A T 15: 96,476,673 (GRCm39) I396N probably benign Het
Slc6a13 A T 6: 121,279,753 (GRCm39) E42D probably benign Het
Stard9 G A 2: 120,544,027 (GRCm39) V4442M probably damaging Het
Sumo3 T A 10: 77,452,071 (GRCm39) probably benign Het
Syngap1 A G 17: 27,177,104 (GRCm39) I356V probably benign Het
Tcam1 C T 11: 106,174,880 (GRCm39) Q112* probably null Het
Tdp2 T A 13: 25,024,378 (GRCm39) L225* probably null Het
Tmprss7 A G 16: 45,478,485 (GRCm39) V747A probably benign Het
Ugt2b34 T A 5: 87,054,223 (GRCm39) Y186F probably benign Het
Usp37 G T 1: 74,514,292 (GRCm39) S293* probably null Het
Vmn1r36 A G 6: 66,693,230 (GRCm39) I109T probably benign Het
Vsig10l T A 7: 43,118,396 (GRCm39) V798E probably benign Het
Zfp36l1 G T 12: 80,159,596 (GRCm39) C18* probably null Het
Zfp959 T C 17: 56,204,427 (GRCm39) Y152H probably damaging Het
Zfyve26 A T 12: 79,296,373 (GRCm39) C1949S probably damaging Het
Zswim9 T A 7: 12,995,529 (GRCm39) E209V probably damaging Het
Other mutations in Ring1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ring1 APN 17 34,241,983 (GRCm39) missense possibly damaging 0.89
IGL01734:Ring1 APN 17 34,242,294 (GRCm39) missense probably damaging 1.00
IGL02420:Ring1 APN 17 34,242,122 (GRCm39) missense possibly damaging 0.67
R4711:Ring1 UTSW 17 34,241,333 (GRCm39) missense possibly damaging 0.72
R4762:Ring1 UTSW 17 34,240,971 (GRCm39) unclassified probably benign
R4770:Ring1 UTSW 17 34,242,361 (GRCm39) missense probably damaging 1.00
R4779:Ring1 UTSW 17 34,241,263 (GRCm39) unclassified probably benign
R4935:Ring1 UTSW 17 34,242,016 (GRCm39) missense probably benign 0.04
R5561:Ring1 UTSW 17 34,240,432 (GRCm39) missense possibly damaging 0.85
R5772:Ring1 UTSW 17 34,241,282 (GRCm39) missense possibly damaging 0.96
R7060:Ring1 UTSW 17 34,242,364 (GRCm39) missense probably damaging 1.00
R7115:Ring1 UTSW 17 34,242,420 (GRCm39) missense probably damaging 0.97
R7363:Ring1 UTSW 17 34,243,336 (GRCm39) missense possibly damaging 0.68
R7380:Ring1 UTSW 17 34,240,694 (GRCm39) missense probably damaging 0.98
R7556:Ring1 UTSW 17 34,240,688 (GRCm39) missense possibly damaging 0.52
R7703:Ring1 UTSW 17 34,242,109 (GRCm39) missense probably damaging 1.00
R9289:Ring1 UTSW 17 34,241,547 (GRCm39) missense possibly damaging 0.73
R9716:Ring1 UTSW 17 34,240,420 (GRCm39) missense possibly damaging 0.85
Z1177:Ring1 UTSW 17 34,240,752 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAGGGCGTCGAAGTTG -3'
(R):5'- TTTCTCAAAGCTTGCCTCTAAAGTC -3'

Sequencing Primer
(F):5'- CGTCGAAGTTGGGGTCC -3'
(R):5'- AAGCTTGCCTCTAAAGTCCCCTTC -3'
Posted On 2018-02-28