Incidental Mutation 'R6235:Ring1'
ID504911
Institutional Source Beutler Lab
Gene Symbol Ring1
Ensembl Gene ENSMUSG00000024325
Gene Namering finger protein 1
SynonymsRing1A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R6235 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34020792-34024680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34023306 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 76 (A76S)
Ref Sequence ENSEMBL: ENSMUSP00000025183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000025186] [ENSMUST00000045467] [ENSMUST00000114303] [ENSMUST00000169397]
Predicted Effect probably damaging
Transcript: ENSMUST00000025183
AA Change: A76S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325
AA Change: A76S

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025186
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083621
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect probably benign
Transcript: ENSMUST00000169397
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199860
Meta Mutation Damage Score 0.4634 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RING finger family, members of which encode proteins characterized by a RING domain, a zinc-binding motif related to the zinc finger domain. The gene product can bind DNA and can act as a transcriptional repressor. It is associated with the multimeric polycomb group protein complex. The gene product interacts with the polycomb group proteins BMI1, EDR1, and CBX4, and colocalizes with these proteins in large nuclear domains. It interacts with the CBX4 protein via its glycine-rich C-terminal domain. The gene maps to the HLA class II region, where it is contiguous with the RING finger genes FABGL and HKE4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygous and heterozygous mutant mice show axial skeleton defects including anterior transformations of vertebrae and rib abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T C 12: 113,491,710 F716L probably benign Het
Akip1 A G 7: 109,707,413 M106V probably benign Het
Aldh1l1 A T 6: 90,564,457 I278F probably benign Het
Aplnr A G 2: 85,137,626 T332A probably benign Het
Aqp4 A G 18: 15,398,113 V197A probably damaging Het
Arid4a A T 12: 71,069,772 probably null Het
Baiap2 A T 11: 119,981,408 N99Y probably damaging Het
Ceacam1 A T 7: 25,471,792 probably null Het
Cep78 T C 19: 15,976,486 probably null Het
Cldn3 T C 5: 134,986,719 F92S possibly damaging Het
Clec16a C A 16: 10,694,635 P812Q probably damaging Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Copg2 A G 6: 30,816,071 I443T probably damaging Het
Crhbp C A 13: 95,443,850 A81S probably damaging Het
Csad A T 15: 102,178,606 V410D probably damaging Het
Ctps G A 4: 120,558,806 L207F probably benign Het
Dab2ip A G 2: 35,723,087 E1003G probably damaging Het
Ddx31 C G 2: 28,844,842 A5G probably benign Het
Dnah12 A T 14: 26,854,804 I3004F probably damaging Het
Fbxo15 A G 18: 84,980,904 probably benign Het
Fbxw28 C A 9: 109,326,190 W356C probably damaging Het
Gimap6 G T 6: 48,702,457 T215K probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Hunk A G 16: 90,432,706 I152V probably damaging Het
Itk T C 11: 46,336,428 E456G probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lars2 T C 9: 123,411,880 V204A probably damaging Het
Lipo1 A G 19: 33,783,563 Y140H probably damaging Het
Lrp1 G A 10: 127,588,177 R809W probably damaging Het
Magi3 C T 3: 104,016,068 G1111D probably damaging Het
Mis18bp1 A T 12: 65,158,408 V47E probably damaging Het
Mpdz T C 4: 81,385,281 E140G probably damaging Het
Myo1d T C 11: 80,692,944 I81V probably benign Het
Nek10 T A 14: 14,821,113 Y26* probably null Het
Ntng2 C A 2: 29,227,979 E152D probably damaging Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Olfr1490 C A 19: 13,654,781 C117* probably null Het
Otud3 A T 4: 138,901,901 V185D probably damaging Het
Parp6 C T 9: 59,630,815 R248W probably benign Het
Pcdhga7 A G 18: 37,716,430 T497A probably benign Het
Ppp1r18 A G 17: 35,873,877 E140G probably damaging Het
Prl3b1 T C 13: 27,247,945 L151P probably damaging Het
Pth1r C T 9: 110,722,316 E572K possibly damaging Het
Ptprq T A 10: 107,635,338 T1401S possibly damaging Het
Rad51ap2 A G 12: 11,457,516 T480A possibly damaging Het
Rax T A 18: 65,935,161 Q291L unknown Het
Reck T C 4: 43,937,450 L734P probably damaging Het
Rgmb A G 17: 15,820,819 F169L probably damaging Het
Rhobtb3 T C 13: 75,892,910 I426M probably damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rpusd2 A G 2: 119,034,857 I12V probably benign Het
Rragd T C 4: 32,995,985 V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 G T 7: 29,116,181 Q95K probably benign Het
S1pr4 T A 10: 81,498,882 N253Y possibly damaging Het
Scn3a A C 2: 65,461,335 V1689G probably damaging Het
Sdhb A G 4: 140,973,673 N147D probably damaging Het
Sdk1 A T 5: 142,034,426 H913L possibly damaging Het
Serpina3i T A 12: 104,266,532 M232K probably damaging Het
Sipa1l2 A T 8: 125,474,871 V646E probably damaging Het
Slc38a1 A T 15: 96,578,792 I396N probably benign Het
Slc6a13 A T 6: 121,302,794 E42D probably benign Het
Stard9 G A 2: 120,713,546 V4442M probably damaging Het
Sumo3 T A 10: 77,616,237 probably benign Het
Syngap1 A G 17: 26,958,130 I356V probably benign Het
Tcam1 C T 11: 106,284,054 Q112* probably null Het
Tdp2 T A 13: 24,840,395 L225* probably null Het
Tmprss7 A G 16: 45,658,122 V747A probably benign Het
Ugt2b34 T A 5: 86,906,364 Y186F probably benign Het
Usp37 G T 1: 74,475,133 S293* probably null Het
Vmn1r36 A G 6: 66,716,246 I109T probably benign Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Zfp36l1 G T 12: 80,112,822 C18* probably null Het
Zfp959 T C 17: 55,897,427 Y152H probably damaging Het
Zfyve26 A T 12: 79,249,599 C1949S probably damaging Het
Zswim9 T A 7: 13,261,603 E209V probably damaging Het
Other mutations in Ring1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ring1 APN 17 34023009 missense possibly damaging 0.89
IGL01734:Ring1 APN 17 34023320 missense probably damaging 1.00
IGL02420:Ring1 APN 17 34023148 missense possibly damaging 0.67
R4711:Ring1 UTSW 17 34022359 missense possibly damaging 0.72
R4762:Ring1 UTSW 17 34021997 unclassified probably benign
R4770:Ring1 UTSW 17 34023387 missense probably damaging 1.00
R4779:Ring1 UTSW 17 34022289 unclassified probably benign
R4935:Ring1 UTSW 17 34023042 missense probably benign 0.04
R5561:Ring1 UTSW 17 34021458 missense possibly damaging 0.85
R5772:Ring1 UTSW 17 34022308 missense possibly damaging 0.96
R7060:Ring1 UTSW 17 34023390 missense probably damaging 1.00
R7115:Ring1 UTSW 17 34023446 missense probably damaging 0.97
R7363:Ring1 UTSW 17 34024362 missense possibly damaging 0.68
R7380:Ring1 UTSW 17 34021720 missense probably damaging 0.98
R7556:Ring1 UTSW 17 34021714 missense possibly damaging 0.52
R7703:Ring1 UTSW 17 34023135 missense probably damaging 1.00
Z1177:Ring1 UTSW 17 34021778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAGGGCGTCGAAGTTG -3'
(R):5'- TTTCTCAAAGCTTGCCTCTAAAGTC -3'

Sequencing Primer
(F):5'- CGTCGAAGTTGGGGTCC -3'
(R):5'- AAGCTTGCCTCTAAAGTCCCCTTC -3'
Posted On2018-02-28