Incidental Mutation 'R6235:Or10w1'
ID 504918
Institutional Source Beutler Lab
Gene Symbol Or10w1
Ensembl Gene ENSMUSG00000061387
Gene Name olfactory receptor family 10 subfamily W member 1
Synonyms Olfr1490, GA_x6K02T2RE5P-3987000-3987950, MOR266-6P
MMRRC Submission 044433-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R6235 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13631810-13632760 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 13632145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 117 (C117*)
Ref Sequence ENSEMBL: ENSMUSP00000151186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000213900]
AlphaFold A0A1L1SVH0
Predicted Effect probably null
Transcript: ENSMUST00000080162
AA Change: C112*
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: C112*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213900
AA Change: C117*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216631
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l T G 8: 44,078,949 (GRCm39) N425T probably benign Het
Adam6b T C 12: 113,455,330 (GRCm39) F716L probably benign Het
Akip1 A G 7: 109,306,620 (GRCm39) M106V probably benign Het
Aldh1l1 A T 6: 90,541,439 (GRCm39) I278F probably benign Het
Aplnr A G 2: 84,967,970 (GRCm39) T332A probably benign Het
Aqp4 A G 18: 15,531,170 (GRCm39) V197A probably damaging Het
Arid4a A T 12: 71,116,546 (GRCm39) probably null Het
Baiap2 A T 11: 119,872,234 (GRCm39) N99Y probably damaging Het
Ceacam1 A T 7: 25,171,217 (GRCm39) probably null Het
Cep78 T C 19: 15,953,850 (GRCm39) probably null Het
Cldn3 T C 5: 135,015,573 (GRCm39) F92S possibly damaging Het
Clec16a C A 16: 10,512,499 (GRCm39) P812Q probably damaging Het
Cnga4 T G 7: 105,056,906 (GRCm39) Y336* probably null Het
Copg2 A G 6: 30,793,006 (GRCm39) I443T probably damaging Het
Crhbp C A 13: 95,580,358 (GRCm39) A81S probably damaging Het
Csad A T 15: 102,087,041 (GRCm39) V410D probably damaging Het
Ctps1 G A 4: 120,416,003 (GRCm39) L207F probably benign Het
Dab2ip A G 2: 35,613,099 (GRCm39) E1003G probably damaging Het
Ddx31 C G 2: 28,734,854 (GRCm39) A5G probably benign Het
Dnah12 A T 14: 26,576,761 (GRCm39) I3004F probably damaging Het
Fbxo15 A G 18: 84,999,029 (GRCm39) probably benign Het
Fbxw28 C A 9: 109,155,258 (GRCm39) W356C probably damaging Het
Gimap6 G T 6: 48,679,391 (GRCm39) T215K probably benign Het
Hspa4 C T 11: 53,153,766 (GRCm39) E702K probably benign Het
Hunk A G 16: 90,229,594 (GRCm39) I152V probably damaging Het
Itk T C 11: 46,227,255 (GRCm39) E456G probably benign Het
Krt40 G A 11: 99,433,920 (GRCm39) A22V possibly damaging Het
Lars2 T C 9: 123,240,945 (GRCm39) V204A probably damaging Het
Lipo3 A G 19: 33,760,963 (GRCm39) Y140H probably damaging Het
Lrp1 G A 10: 127,424,046 (GRCm39) R809W probably damaging Het
Magi3 C T 3: 103,923,384 (GRCm39) G1111D probably damaging Het
Mis18bp1 A T 12: 65,205,182 (GRCm39) V47E probably damaging Het
Mpdz T C 4: 81,303,518 (GRCm39) E140G probably damaging Het
Myo1d T C 11: 80,583,770 (GRCm39) I81V probably benign Het
Nek10 T A 14: 14,821,113 (GRCm38) Y26* probably null Het
Ntng2 C A 2: 29,117,991 (GRCm39) E152D probably damaging Het
Or5m9b T C 2: 85,905,510 (GRCm39) L142P possibly damaging Het
Otud3 A T 4: 138,629,212 (GRCm39) V185D probably damaging Het
Parp6 C T 9: 59,538,098 (GRCm39) R248W probably benign Het
Pcdhga7 A G 18: 37,849,483 (GRCm39) T497A probably benign Het
Ppp1r18 A G 17: 36,184,769 (GRCm39) E140G probably damaging Het
Prl3b1 T C 13: 27,431,928 (GRCm39) L151P probably damaging Het
Pth1r C T 9: 110,551,384 (GRCm39) E572K possibly damaging Het
Ptprq T A 10: 107,471,199 (GRCm39) T1401S possibly damaging Het
Rad51ap2 A G 12: 11,507,517 (GRCm39) T480A possibly damaging Het
Rax T A 18: 66,068,232 (GRCm39) Q291L unknown Het
Reck T C 4: 43,937,450 (GRCm39) L734P probably damaging Het
Rgmb A G 17: 16,041,081 (GRCm39) F169L probably damaging Het
Rhobtb3 T C 13: 76,041,029 (GRCm39) I426M probably damaging Het
Ring1 C A 17: 34,242,280 (GRCm39) A76S probably damaging Het
Robo3 T G 9: 37,332,225 (GRCm39) Y891S probably damaging Het
Rpusd2 A G 2: 118,865,338 (GRCm39) I12V probably benign Het
Rragd T C 4: 32,995,985 (GRCm39) V165A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Homo
Ryr1 G T 7: 28,815,606 (GRCm39) Q95K probably benign Het
S1pr4 T A 10: 81,334,716 (GRCm39) N253Y possibly damaging Het
Scn3a A C 2: 65,291,679 (GRCm39) V1689G probably damaging Het
Sdhb A G 4: 140,700,984 (GRCm39) N147D probably damaging Het
Sdk1 A T 5: 142,020,181 (GRCm39) H913L possibly damaging Het
Serpina3i T A 12: 104,232,791 (GRCm39) M232K probably damaging Het
Sipa1l2 A T 8: 126,201,610 (GRCm39) V646E probably damaging Het
Slc38a1 A T 15: 96,476,673 (GRCm39) I396N probably benign Het
Slc6a13 A T 6: 121,279,753 (GRCm39) E42D probably benign Het
Stard9 G A 2: 120,544,027 (GRCm39) V4442M probably damaging Het
Sumo3 T A 10: 77,452,071 (GRCm39) probably benign Het
Syngap1 A G 17: 27,177,104 (GRCm39) I356V probably benign Het
Tcam1 C T 11: 106,174,880 (GRCm39) Q112* probably null Het
Tdp2 T A 13: 25,024,378 (GRCm39) L225* probably null Het
Tmprss7 A G 16: 45,478,485 (GRCm39) V747A probably benign Het
Ugt2b34 T A 5: 87,054,223 (GRCm39) Y186F probably benign Het
Usp37 G T 1: 74,514,292 (GRCm39) S293* probably null Het
Vmn1r36 A G 6: 66,693,230 (GRCm39) I109T probably benign Het
Vsig10l T A 7: 43,118,396 (GRCm39) V798E probably benign Het
Zfp36l1 G T 12: 80,159,596 (GRCm39) C18* probably null Het
Zfp959 T C 17: 56,204,427 (GRCm39) Y152H probably damaging Het
Zfyve26 A T 12: 79,296,373 (GRCm39) C1949S probably damaging Het
Zswim9 T A 7: 12,995,529 (GRCm39) E209V probably damaging Het
Other mutations in Or10w1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Or10w1 APN 19 13,632,297 (GRCm39) missense probably damaging 0.96
IGL01335:Or10w1 APN 19 13,632,540 (GRCm39) missense probably damaging 1.00
IGL01561:Or10w1 APN 19 13,632,269 (GRCm39) missense probably benign
IGL01644:Or10w1 APN 19 13,632,768 (GRCm39) utr 3 prime probably benign
IGL02257:Or10w1 APN 19 13,632,629 (GRCm39) missense probably benign
IGL02282:Or10w1 APN 19 13,632,622 (GRCm39) missense probably damaging 1.00
IGL02355:Or10w1 APN 19 13,632,597 (GRCm39) missense probably benign 0.02
IGL02362:Or10w1 APN 19 13,632,597 (GRCm39) missense probably benign 0.02
IGL02639:Or10w1 APN 19 13,631,960 (GRCm39) missense possibly damaging 0.73
R0078:Or10w1 UTSW 19 13,632,179 (GRCm39) missense probably benign 0.00
R0278:Or10w1 UTSW 19 13,632,129 (GRCm39) missense probably damaging 1.00
R0278:Or10w1 UTSW 19 13,632,128 (GRCm39) missense probably damaging 1.00
R0506:Or10w1 UTSW 19 13,632,261 (GRCm39) missense possibly damaging 0.62
R0927:Or10w1 UTSW 19 13,631,816 (GRCm39) missense probably damaging 0.99
R1087:Or10w1 UTSW 19 13,632,376 (GRCm39) nonsense probably null
R1762:Or10w1 UTSW 19 13,631,868 (GRCm39) missense probably benign
R2901:Or10w1 UTSW 19 13,632,309 (GRCm39) missense probably damaging 1.00
R2907:Or10w1 UTSW 19 13,632,611 (GRCm39) missense possibly damaging 0.84
R3625:Or10w1 UTSW 19 13,632,346 (GRCm39) nonsense probably null
R3838:Or10w1 UTSW 19 13,632,321 (GRCm39) missense probably benign 0.00
R4745:Or10w1 UTSW 19 13,632,750 (GRCm39) missense probably benign
R4804:Or10w1 UTSW 19 13,631,882 (GRCm39) missense probably benign
R5026:Or10w1 UTSW 19 13,632,296 (GRCm39) missense probably benign 0.03
R5314:Or10w1 UTSW 19 13,632,630 (GRCm39) missense probably benign 0.08
R6052:Or10w1 UTSW 19 13,631,871 (GRCm39) missense possibly damaging 0.95
R7405:Or10w1 UTSW 19 13,632,246 (GRCm39) missense probably benign 0.14
R7557:Or10w1 UTSW 19 13,632,390 (GRCm39) missense possibly damaging 0.71
R8038:Or10w1 UTSW 19 13,632,719 (GRCm39) missense possibly damaging 0.91
R8338:Or10w1 UTSW 19 13,632,216 (GRCm39) missense possibly damaging 0.92
R8366:Or10w1 UTSW 19 13,631,903 (GRCm39) missense probably damaging 1.00
R8496:Or10w1 UTSW 19 13,632,388 (GRCm39) missense probably damaging 0.96
R8783:Or10w1 UTSW 19 13,632,323 (GRCm39) missense probably damaging 1.00
R8838:Or10w1 UTSW 19 13,632,371 (GRCm39) missense probably damaging 0.98
R8859:Or10w1 UTSW 19 13,632,246 (GRCm39) missense probably damaging 0.99
R9064:Or10w1 UTSW 19 13,632,719 (GRCm39) missense possibly damaging 0.91
R9161:Or10w1 UTSW 19 13,632,038 (GRCm39) missense probably damaging 1.00
R9466:Or10w1 UTSW 19 13,631,796 (GRCm39) start codon destroyed probably null
R9596:Or10w1 UTSW 19 13,632,002 (GRCm39) missense probably damaging 1.00
R9623:Or10w1 UTSW 19 13,632,414 (GRCm39) missense probably damaging 1.00
Z1176:Or10w1 UTSW 19 13,631,827 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTGGTCTCCATCCAGACTG -3'
(R):5'- AAGAAGTGCTCTATTCCCCTG -3'

Sequencing Primer
(F):5'- TGGTCTCCATCCAGACTGAAACAC -3'
(R):5'- TGTCCTGACAGAATGGTAGACAG -3'
Posted On 2018-02-28