Incidental Mutation 'R6236:Ifi203'
ID504923
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6236 (G1)
Quality Score134.008
Status Validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173933913 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 190 (V190A)
Ref Sequence ENSEMBL: ENSMUSP00000122424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably benign
Transcript: ENSMUST00000042228
AA Change: V190A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997
AA Change: V190A

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect probably benign
Transcript: ENSMUST00000129829
AA Change: V190A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: V190A

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140143
Predicted Effect probably benign
Transcript: ENSMUST00000156895
AA Change: V190A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997
AA Change: V190A

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,207 T703A possibly damaging Het
Acd C T 8: 105,700,495 A49T probably benign Het
Acer1 T A 17: 56,955,231 I224F probably benign Het
Acvr1 T C 2: 58,477,666 D161G probably benign Het
Catsper4 T C 4: 134,221,576 I111V probably benign Het
Ccdc173 A C 2: 69,758,041 probably null Het
Chst14 T A 2: 118,927,516 C264S probably damaging Het
Clnk T C 5: 38,713,199 T339A probably benign Het
Cnot4 T C 6: 35,068,673 K201R probably benign Het
Col19a1 A G 1: 24,279,949 V1020A probably damaging Het
Cts6 C A 13: 61,196,378 E287* probably null Het
Dbf4 T C 5: 8,398,579 probably benign Het
Diaph3 G A 14: 87,037,568 R140* probably null Het
Faah T C 4: 115,999,589 I459V probably benign Het
Fbxw2 A T 2: 34,822,833 L72H probably damaging Het
Fstl4 G A 11: 53,186,335 G640S probably benign Het
Gabrb1 C T 5: 72,108,320 T186M probably damaging Het
Gata2 T C 6: 88,202,566 probably null Het
Kdm3a T C 6: 71,611,657 E456G probably benign Het
Kl A T 5: 150,953,290 T192S probably damaging Het
Klhl3 G A 13: 58,085,062 A77V probably damaging Het
Klri2 A G 6: 129,738,895 F114L probably benign Het
Lonp2 A T 8: 86,636,587 R278* probably null Het
Lrp5 A T 19: 3,630,483 probably null Het
Med13 T A 11: 86,328,531 H363L probably damaging Het
Metap1d T G 2: 71,515,678 F194L probably benign Het
Misp A G 10: 79,827,122 K458E probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myh2 A G 11: 67,190,331 T1258A probably benign Het
Nipbl T A 15: 8,324,580 D1691V possibly damaging Het
Nr1i2 C T 16: 38,265,938 C55Y probably damaging Het
Olfr746 T C 14: 50,653,800 S188P probably damaging Het
Olfr836 A T 9: 19,121,113 I50F possibly damaging Het
Pcdhgb4 T C 18: 37,721,292 Y247H probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Ric1 T A 19: 29,595,426 D755E possibly damaging Het
Sez6l G T 5: 112,475,244 T147K possibly damaging Het
Ski A G 4: 155,159,544 F451S probably benign Het
Slc45a2 C T 15: 11,022,072 T300I probably benign Het
Smarca2 T C 19: 26,696,213 V1050A probably benign Het
Spag1 T C 15: 36,211,135 S476P probably damaging Het
Sptbn2 T A 19: 4,748,138 S1964T probably benign Het
Sucla2 T A 14: 73,593,750 D434E probably benign Het
Tbl3 G A 17: 24,700,743 T779I probably benign Het
Tlr2 T A 3: 83,838,131 E215V probably benign Het
Tomm40 G A 7: 19,703,356 P227S probably benign Het
Tpp2 T A 1: 43,977,317 S711T probably benign Het
Traj32 T A 14: 54,186,108 Y2* probably null Het
Trim34b A G 7: 104,336,318 R387G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp5 T C 6: 124,818,478 T651A probably benign Het
Vmn1r188 T C 13: 22,088,244 S123P probably damaging Het
Zdhhc14 T C 17: 5,493,643 L66P probably damaging Het
Zfp712 C T 13: 67,040,621 C614Y probably damaging Het
Zfp827 A G 8: 79,070,476 K397R probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTCATTGTCTAGGGCGATGAA -3'
(R):5'- TGGAATAAAGTCCTTGGGCACA -3'

Sequencing Primer
(F):5'- TTGTCTAGGGCGATGAAAATTAAGAC -3'
(R):5'- TGGTTTCAATAAGCCGACGC -3'
Posted On2018-02-28