Incidental Mutation 'R6236:Ifi203'
ID 504923
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Name interferon activated gene 203
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R6236 (G1)
Quality Score 134.008
Status Validated
Chromosome 1
Chromosomal Location 173920407-173942672 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 173933913 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 190 (V190A)
Ref Sequence ENSEMBL: ENSMUSP00000122424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042228
AA Change: V190A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997
AA Change: V190A

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect probably benign
Transcript: ENSMUST00000129829
AA Change: V190A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: V190A

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140143
Predicted Effect probably benign
Transcript: ENSMUST00000156895
AA Change: V190A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997
AA Change: V190A

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,207 T703A possibly damaging Het
Acd C T 8: 105,700,495 A49T probably benign Het
Acer1 T A 17: 56,955,231 I224F probably benign Het
Acvr1 T C 2: 58,477,666 D161G probably benign Het
Catsper4 T C 4: 134,221,576 I111V probably benign Het
Ccdc173 A C 2: 69,758,041 probably null Het
Chst14 T A 2: 118,927,516 C264S probably damaging Het
Clnk T C 5: 38,713,199 T339A probably benign Het
Cnot4 T C 6: 35,068,673 K201R probably benign Het
Col19a1 A G 1: 24,279,949 V1020A probably damaging Het
Cts6 C A 13: 61,196,378 E287* probably null Het
Dbf4 T C 5: 8,398,579 probably benign Het
Diaph3 G A 14: 87,037,568 R140* probably null Het
Faah T C 4: 115,999,589 I459V probably benign Het
Fbxw2 A T 2: 34,822,833 L72H probably damaging Het
Fstl4 G A 11: 53,186,335 G640S probably benign Het
Gabrb1 C T 5: 72,108,320 T186M probably damaging Het
Gata2 T C 6: 88,202,566 probably null Het
Kdm3a T C 6: 71,611,657 E456G probably benign Het
Kl A T 5: 150,953,290 T192S probably damaging Het
Klhl3 G A 13: 58,085,062 A77V probably damaging Het
Klri2 A G 6: 129,738,895 F114L probably benign Het
Lonp2 A T 8: 86,636,587 R278* probably null Het
Lrp5 A T 19: 3,630,483 probably null Het
Med13 T A 11: 86,328,531 H363L probably damaging Het
Metap1d T G 2: 71,515,678 F194L probably benign Het
Misp A G 10: 79,827,122 K458E probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myh2 A G 11: 67,190,331 T1258A probably benign Het
Nipbl T A 15: 8,324,580 D1691V possibly damaging Het
Nr1i2 C T 16: 38,265,938 C55Y probably damaging Het
Olfr746 T C 14: 50,653,800 S188P probably damaging Het
Olfr836 A T 9: 19,121,113 I50F possibly damaging Het
Pcdhgb4 T C 18: 37,721,292 Y247H probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Ric1 T A 19: 29,595,426 D755E possibly damaging Het
Sez6l G T 5: 112,475,244 T147K possibly damaging Het
Ski A G 4: 155,159,544 F451S probably benign Het
Slc45a2 C T 15: 11,022,072 T300I probably benign Het
Smarca2 T C 19: 26,696,213 V1050A probably benign Het
Spag1 T C 15: 36,211,135 S476P probably damaging Het
Sptbn2 T A 19: 4,748,138 S1964T probably benign Het
Sucla2 T A 14: 73,593,750 D434E probably benign Het
Tbl3 G A 17: 24,700,743 T779I probably benign Het
Tlr2 T A 3: 83,838,131 E215V probably benign Het
Tomm40 G A 7: 19,703,356 P227S probably benign Het
Tpp2 T A 1: 43,977,317 S711T probably benign Het
Traj32 T A 14: 54,186,108 Y2* probably null Het
Trim34b A G 7: 104,336,318 R387G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp5 T C 6: 124,818,478 T651A probably benign Het
Vmn1r188 T C 13: 22,088,244 S123P probably damaging Het
Zdhhc14 T C 17: 5,493,643 L66P probably damaging Het
Zfp712 C T 13: 67,040,621 C614Y probably damaging Het
Zfp827 A G 8: 79,070,476 K397R probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
R8537:Ifi203 UTSW 1 173928906 intron probably benign
R8919:Ifi203 UTSW 1 173928928 missense unknown
R8936:Ifi203 UTSW 1 173929291 intron probably benign
R9081:Ifi203 UTSW 1 173929482 missense unknown
R9223:Ifi203 UTSW 1 173937871 missense probably benign 0.42
R9255:Ifi203 UTSW 1 173929221 missense unknown
R9351:Ifi203 UTSW 1 173922567 missense probably benign 0.33
R9397:Ifi203 UTSW 1 173937981 missense probably damaging 0.99
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTCATTGTCTAGGGCGATGAA -3'
(R):5'- TGGAATAAAGTCCTTGGGCACA -3'

Sequencing Primer
(F):5'- TTGTCTAGGGCGATGAAAATTAAGAC -3'
(R):5'- TGGTTTCAATAAGCCGACGC -3'
Posted On 2018-02-28