Incidental Mutation 'R6236:Kdm3a'
ID504942
Institutional Source Beutler Lab
Gene Symbol Kdm3a
Ensembl Gene ENSMUSG00000053470
Gene Namelysine (K)-specific demethylase 3A
SynonymsC230043E16Rik, Jmjd1a, Tsga, 1700105C21Rik, Jmjd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6236 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71588972-71632990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71611657 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 456 (E456G)
Ref Sequence ENSEMBL: ENSMUSP00000145959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065509] [ENSMUST00000167220] [ENSMUST00000205289] [ENSMUST00000207023]
Predicted Effect probably benign
Transcript: ENSMUST00000065509
AA Change: E456G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065716
Gene: ENSMUSG00000053470
AA Change: E456G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167220
AA Change: E456G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128789
Gene: ENSMUSG00000053470
AA Change: E456G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205289
AA Change: E456G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206704
Predicted Effect probably benign
Transcript: ENSMUST00000206916
Predicted Effect probably benign
Transcript: ENSMUST00000207023
AA Change: E456G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein that contains a jumonji domain and may play a role in hormone-dependent transcriptional activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Male mice homozygous for a hypomorphic allele display infertility, oligoasthenoteratozoospermia, small testis, and impaired spermiogenesis. Mice homozygous for a null allele exhibit abnormal spermatogenesis and obesity associated with hyperlipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,207 T703A possibly damaging Het
Acd C T 8: 105,700,495 A49T probably benign Het
Acer1 T A 17: 56,955,231 I224F probably benign Het
Acvr1 T C 2: 58,477,666 D161G probably benign Het
Catsper4 T C 4: 134,221,576 I111V probably benign Het
Ccdc173 A C 2: 69,758,041 probably null Het
Chst14 T A 2: 118,927,516 C264S probably damaging Het
Clnk T C 5: 38,713,199 T339A probably benign Het
Cnot4 T C 6: 35,068,673 K201R probably benign Het
Col19a1 A G 1: 24,279,949 V1020A probably damaging Het
Cts6 C A 13: 61,196,378 E287* probably null Het
Dbf4 T C 5: 8,398,579 probably benign Het
Diaph3 G A 14: 87,037,568 R140* probably null Het
Faah T C 4: 115,999,589 I459V probably benign Het
Fbxw2 A T 2: 34,822,833 L72H probably damaging Het
Fstl4 G A 11: 53,186,335 G640S probably benign Het
Gabrb1 C T 5: 72,108,320 T186M probably damaging Het
Gata2 T C 6: 88,202,566 probably null Het
Ifi203 A G 1: 173,933,913 V190A probably benign Het
Kl A T 5: 150,953,290 T192S probably damaging Het
Klhl3 G A 13: 58,085,062 A77V probably damaging Het
Klri2 A G 6: 129,738,895 F114L probably benign Het
Lonp2 A T 8: 86,636,587 R278* probably null Het
Lrp5 A T 19: 3,630,483 probably null Het
Med13 T A 11: 86,328,531 H363L probably damaging Het
Metap1d T G 2: 71,515,678 F194L probably benign Het
Misp A G 10: 79,827,122 K458E probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myh2 A G 11: 67,190,331 T1258A probably benign Het
Nipbl T A 15: 8,324,580 D1691V possibly damaging Het
Nr1i2 C T 16: 38,265,938 C55Y probably damaging Het
Olfr746 T C 14: 50,653,800 S188P probably damaging Het
Olfr836 A T 9: 19,121,113 I50F possibly damaging Het
Pcdhgb4 T C 18: 37,721,292 Y247H probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Ric1 T A 19: 29,595,426 D755E possibly damaging Het
Sez6l G T 5: 112,475,244 T147K possibly damaging Het
Ski A G 4: 155,159,544 F451S probably benign Het
Slc45a2 C T 15: 11,022,072 T300I probably benign Het
Smarca2 T C 19: 26,696,213 V1050A probably benign Het
Spag1 T C 15: 36,211,135 S476P probably damaging Het
Sptbn2 T A 19: 4,748,138 S1964T probably benign Het
Sucla2 T A 14: 73,593,750 D434E probably benign Het
Tbl3 G A 17: 24,700,743 T779I probably benign Het
Tlr2 T A 3: 83,838,131 E215V probably benign Het
Tomm40 G A 7: 19,703,356 P227S probably benign Het
Tpp2 T A 1: 43,977,317 S711T probably benign Het
Traj32 T A 14: 54,186,108 Y2* probably null Het
Trim34b A G 7: 104,336,318 R387G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp5 T C 6: 124,818,478 T651A probably benign Het
Vmn1r188 T C 13: 22,088,244 S123P probably damaging Het
Zdhhc14 T C 17: 5,493,643 L66P probably damaging Het
Zfp712 C T 13: 67,040,621 C614Y probably damaging Het
Zfp827 A G 8: 79,070,476 K397R probably damaging Het
Other mutations in Kdm3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Kdm3a APN 6 71600117 missense probably damaging 1.00
IGL02219:Kdm3a APN 6 71600734 missense probably benign 0.01
IGL02423:Kdm3a APN 6 71614003 splice site probably benign
IGL02427:Kdm3a APN 6 71592200 splice site probably benign
IGL02519:Kdm3a APN 6 71611586 missense probably benign 0.04
IGL03143:Kdm3a APN 6 71596861 missense probably damaging 0.98
IGL03279:Kdm3a APN 6 71611675 missense probably benign
R0194:Kdm3a UTSW 6 71624594 missense probably null 0.44
R0408:Kdm3a UTSW 6 71611679 missense probably benign 0.00
R0426:Kdm3a UTSW 6 71600755 missense probably damaging 1.00
R0608:Kdm3a UTSW 6 71620046 missense probably benign 0.01
R1175:Kdm3a UTSW 6 71600027 missense possibly damaging 0.94
R1835:Kdm3a UTSW 6 71613956 missense probably benign 0.14
R3821:Kdm3a UTSW 6 71611677 missense probably benign 0.00
R5083:Kdm3a UTSW 6 71621362 missense probably damaging 1.00
R5536:Kdm3a UTSW 6 71611936 missense probably benign 0.31
R5903:Kdm3a UTSW 6 71632250 start gained probably benign
R5965:Kdm3a UTSW 6 71621380 missense probably benign 0.21
R6541:Kdm3a UTSW 6 71594533 missense possibly damaging 0.69
R6666:Kdm3a UTSW 6 71611990 missense probably benign 0.00
R7090:Kdm3a UTSW 6 71595545 missense possibly damaging 0.69
R7112:Kdm3a UTSW 6 71632170 missense probably benign
R7136:Kdm3a UTSW 6 71611780 missense probably benign 0.00
R7163:Kdm3a UTSW 6 71632077 missense probably damaging 1.00
R7608:Kdm3a UTSW 6 71600747 missense probably benign 0.01
R7614:Kdm3a UTSW 6 71591953 missense possibly damaging 0.82
R7683:Kdm3a UTSW 6 71599454 missense probably benign
R7687:Kdm3a UTSW 6 71599492 missense possibly damaging 0.64
R7868:Kdm3a UTSW 6 71595489 missense probably benign 0.31
R8447:Kdm3a UTSW 6 71611897 missense probably benign
RF053:Kdm3a UTSW 6 71632049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TGAGATGTGAAACACTTACGAGTC -3'
(R):5'- ACTTGAAAATTCTGAGTGAGCCC -3'

Sequencing Primer
(F):5'- CACTTACGAGTCTGGGTTTTATTAC -3'
(R):5'- TGAGCCCAAAGGTAGCTGTATCC -3'
Posted On2018-02-28