Incidental Mutation 'R6236:Lrp5'
ID504971
Institutional Source Beutler Lab
Gene Symbol Lrp5
Ensembl Gene ENSMUSG00000024913
Gene Namelow density lipoprotein receptor-related protein 5
SynonymsLR3, LRP7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R6236 (G1)
Quality Score174.009
Status Validated
Chromosome19
Chromosomal Location3584828-3686564 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 3630483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000025856] [ENSMUST00000176867] [ENSMUST00000176867] [ENSMUST00000177330]
Predicted Effect probably null
Transcript: ENSMUST00000025856
SMART Domains Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
EGF 603 640 2.48e-1 SMART
LY 666 708 5.92e-8 SMART
LY 709 751 5.65e-14 SMART
LY 752 795 3.81e-11 SMART
LY 796 837 3.54e-6 SMART
LY 838 877 1.33e-1 SMART
EGF 904 941 1.22e0 SMART
LY 968 1009 4.39e-2 SMART
LY 1015 1057 1.81e0 SMART
LY 1058 1102 9.47e-7 SMART
LY 1103 1145 6.91e-9 SMART
LY 1146 1186 1.53e0 SMART
EGF 1215 1253 2.85e-1 SMART
LDLa 1257 1296 1.23e-13 SMART
LDLa 1297 1333 3.26e-9 SMART
LDLa 1334 1371 1.31e-13 SMART
transmembrane domain 1384 1406 N/A INTRINSIC
low complexity region 1494 1503 N/A INTRINSIC
low complexity region 1571 1578 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000025856
SMART Domains Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
EGF 603 640 2.48e-1 SMART
LY 666 708 5.92e-8 SMART
LY 709 751 5.65e-14 SMART
LY 752 795 3.81e-11 SMART
LY 796 837 3.54e-6 SMART
LY 838 877 1.33e-1 SMART
EGF 904 941 1.22e0 SMART
LY 968 1009 4.39e-2 SMART
LY 1015 1057 1.81e0 SMART
LY 1058 1102 9.47e-7 SMART
LY 1103 1145 6.91e-9 SMART
LY 1146 1186 1.53e0 SMART
EGF 1215 1253 2.85e-1 SMART
LDLa 1257 1296 1.23e-13 SMART
LDLa 1297 1333 3.26e-9 SMART
LDLa 1334 1371 1.31e-13 SMART
transmembrane domain 1384 1406 N/A INTRINSIC
low complexity region 1494 1503 N/A INTRINSIC
low complexity region 1571 1578 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176867
SMART Domains Protein: ENSMUSP00000135654
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176867
SMART Domains Protein: ENSMUSP00000135654
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177330
SMART Domains Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,207 T703A possibly damaging Het
Acd C T 8: 105,700,495 A49T probably benign Het
Acer1 T A 17: 56,955,231 I224F probably benign Het
Acvr1 T C 2: 58,477,666 D161G probably benign Het
Catsper4 T C 4: 134,221,576 I111V probably benign Het
Ccdc173 A C 2: 69,758,041 probably null Het
Chst14 T A 2: 118,927,516 C264S probably damaging Het
Clnk T C 5: 38,713,199 T339A probably benign Het
Cnot4 T C 6: 35,068,673 K201R probably benign Het
Col19a1 A G 1: 24,279,949 V1020A probably damaging Het
Cts6 C A 13: 61,196,378 E287* probably null Het
Dbf4 T C 5: 8,398,579 probably benign Het
Diaph3 G A 14: 87,037,568 R140* probably null Het
Faah T C 4: 115,999,589 I459V probably benign Het
Fbxw2 A T 2: 34,822,833 L72H probably damaging Het
Fstl4 G A 11: 53,186,335 G640S probably benign Het
Gabrb1 C T 5: 72,108,320 T186M probably damaging Het
Gata2 T C 6: 88,202,566 probably null Het
Ifi203 A G 1: 173,933,913 V190A probably benign Het
Kdm3a T C 6: 71,611,657 E456G probably benign Het
Kl A T 5: 150,953,290 T192S probably damaging Het
Klhl3 G A 13: 58,085,062 A77V probably damaging Het
Klri2 A G 6: 129,738,895 F114L probably benign Het
Lonp2 A T 8: 86,636,587 R278* probably null Het
Med13 T A 11: 86,328,531 H363L probably damaging Het
Metap1d T G 2: 71,515,678 F194L probably benign Het
Misp A G 10: 79,827,122 K458E probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myh2 A G 11: 67,190,331 T1258A probably benign Het
Nipbl T A 15: 8,324,580 D1691V possibly damaging Het
Nr1i2 C T 16: 38,265,938 C55Y probably damaging Het
Olfr746 T C 14: 50,653,800 S188P probably damaging Het
Olfr836 A T 9: 19,121,113 I50F possibly damaging Het
Pcdhgb4 T C 18: 37,721,292 Y247H probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Ric1 T A 19: 29,595,426 D755E possibly damaging Het
Sez6l G T 5: 112,475,244 T147K possibly damaging Het
Ski A G 4: 155,159,544 F451S probably benign Het
Slc45a2 C T 15: 11,022,072 T300I probably benign Het
Smarca2 T C 19: 26,696,213 V1050A probably benign Het
Spag1 T C 15: 36,211,135 S476P probably damaging Het
Sptbn2 T A 19: 4,748,138 S1964T probably benign Het
Sucla2 T A 14: 73,593,750 D434E probably benign Het
Tbl3 G A 17: 24,700,743 T779I probably benign Het
Tlr2 T A 3: 83,838,131 E215V probably benign Het
Tomm40 G A 7: 19,703,356 P227S probably benign Het
Tpp2 T A 1: 43,977,317 S711T probably benign Het
Traj32 T A 14: 54,186,108 Y2* probably null Het
Trim34b A G 7: 104,336,318 R387G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp5 T C 6: 124,818,478 T651A probably benign Het
Vmn1r188 T C 13: 22,088,244 S123P probably damaging Het
Zdhhc14 T C 17: 5,493,643 L66P probably damaging Het
Zfp712 C T 13: 67,040,621 C614Y probably damaging Het
Zfp827 A G 8: 79,070,476 K397R probably damaging Het
Other mutations in Lrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrp5 APN 19 3649404 missense probably benign
IGL00902:Lrp5 APN 19 3600774 missense probably damaging 1.00
IGL02032:Lrp5 APN 19 3615886 splice site probably benign
IGL02331:Lrp5 APN 19 3591816 missense possibly damaging 0.64
IGL02401:Lrp5 APN 19 3593585 missense probably damaging 1.00
IGL02471:Lrp5 APN 19 3602408 missense probably benign 0.31
IGL02572:Lrp5 APN 19 3614283 missense probably benign 0.17
IGL02637:Lrp5 APN 19 3630269 missense probably benign 0.03
IGL02696:Lrp5 APN 19 3602253 missense probably benign
IGL02742:Lrp5 APN 19 3604022 missense probably damaging 0.99
IGL02804:Lrp5 APN 19 3600777 missense possibly damaging 0.63
IGL03089:Lrp5 APN 19 3620314 splice site probably null
IGL03243:Lrp5 APN 19 3630159 missense probably benign 0.12
Contrarian UTSW 19 3659355 missense probably damaging 1.00
Contrarian2 UTSW 19 3652296 missense probably damaging 1.00
lucent UTSW 19 3686353 critical splice donor site probably null
Microtome UTSW 19 3622638 missense probably damaging 1.00
r18 UTSW 19 small insertion
Spicule UTSW 19 3612197 critical splice donor site probably null
stirrup UTSW 19 3600753 missense probably damaging 1.00
PIT4494001:Lrp5 UTSW 19 3610091 missense probably damaging 1.00
R0219:Lrp5 UTSW 19 3597349 missense probably damaging 1.00
R0526:Lrp5 UTSW 19 3628295 missense probably damaging 1.00
R0597:Lrp5 UTSW 19 3600777 missense possibly damaging 0.63
R0883:Lrp5 UTSW 19 3605308 missense probably damaging 1.00
R1086:Lrp5 UTSW 19 3649476 missense probably benign 0.28
R1417:Lrp5 UTSW 19 3586425 missense probably benign 0.04
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1533:Lrp5 UTSW 19 3614234 missense probably benign 0.17
R1538:Lrp5 UTSW 19 3647585 missense possibly damaging 0.70
R1856:Lrp5 UTSW 19 3597346 missense probably benign 0.18
R1930:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1931:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1932:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1951:Lrp5 UTSW 19 3620298 missense possibly damaging 0.89
R2016:Lrp5 UTSW 19 3610056 missense probably benign 0.04
R2131:Lrp5 UTSW 19 3622708 missense possibly damaging 0.87
R2153:Lrp5 UTSW 19 3614339 missense probably benign 0.22
R2403:Lrp5 UTSW 19 3597430 missense probably damaging 1.00
R3158:Lrp5 UTSW 19 3615849 missense probably damaging 0.97
R3771:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3772:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3773:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3825:Lrp5 UTSW 19 3605290 nonsense probably null
R3887:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3888:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3893:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3917:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R4279:Lrp5 UTSW 19 3591778 missense possibly damaging 0.94
R4714:Lrp5 UTSW 19 3659454 missense probably damaging 1.00
R4825:Lrp5 UTSW 19 3614292 missense probably damaging 1.00
R5102:Lrp5 UTSW 19 3659304 missense probably damaging 0.96
R5138:Lrp5 UTSW 19 3628319 missense probably benign 0.03
R5497:Lrp5 UTSW 19 3602319 missense probably damaging 1.00
R5632:Lrp5 UTSW 19 3622512 missense probably benign
R5887:Lrp5 UTSW 19 3604094 missense probably benign 0.01
R5950:Lrp5 UTSW 19 3602333 missense probably benign 0.17
R5987:Lrp5 UTSW 19 3628299 missense probably damaging 1.00
R6080:Lrp5 UTSW 19 3628316 missense probably benign 0.32
R6181:Lrp5 UTSW 19 3628427 missense probably damaging 1.00
R6332:Lrp5 UTSW 19 3659355 missense probably damaging 1.00
R6511:Lrp5 UTSW 19 3652296 missense probably damaging 1.00
R6641:Lrp5 UTSW 19 3652287 missense probably damaging 1.00
R6791:Lrp5 UTSW 19 3600753 missense probably damaging 1.00
R6865:Lrp5 UTSW 19 3620013 critical splice donor site probably null
R6906:Lrp5 UTSW 19 3622638 missense probably damaging 1.00
R6922:Lrp5 UTSW 19 3605301 missense probably damaging 1.00
R7091:Lrp5 UTSW 19 3630184 missense probably damaging 1.00
R7303:Lrp5 UTSW 19 3591774 missense probably damaging 0.99
R7368:Lrp5 UTSW 19 3620085 missense possibly damaging 0.95
R7381:Lrp5 UTSW 19 3593588 missense probably benign 0.20
R7385:Lrp5 UTSW 19 3612197 critical splice donor site probably null
R7392:Lrp5 UTSW 19 3610199 missense probably damaging 1.00
R7448:Lrp5 UTSW 19 3649439 missense probably benign 0.01
R7585:Lrp5 UTSW 19 3604094 missense possibly damaging 0.88
R7662:Lrp5 UTSW 19 3686353 critical splice donor site probably null
R7984:Lrp5 UTSW 19 3612342 missense probably damaging 1.00
R8056:Lrp5 UTSW 19 3597337 missense probably damaging 0.98
R8391:Lrp5 UTSW 19 3604185 missense probably damaging 1.00
R8881:Lrp5 UTSW 19 3591015 missense probably damaging 0.98
Z1177:Lrp5 UTSW 19 3628345 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATCGTCGGTCCAGTACAC -3'
(R):5'- GACAAGTGGCAGAGGCTCTTAC -3'

Sequencing Primer
(F):5'- TCGGTCCAGTACACGTAGC -3'
(R):5'- TGGCAGAGGCTCTTACACACAG -3'
Posted On2018-02-28