Mutagenetix > Incidental Mutations

Incidental Mutation 'R6237:Cr2'

504978

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

044362-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R6237 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 195157502 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 539 (H539L)

Ref Sequence

ENSEMBL: ENSMUSP00000141538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: H539L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: H539L

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: H242L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: H242L

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: H539L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: H539L

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

probably benign
Transcript: ENSMUST00000210219
AA Change: H915L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

Meta Mutation Damage Score

0.4471

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 119,615,763	R380H	probably damaging	Het
Akr1c12	C	A	13: 4,275,768	D109Y	possibly damaging	Het
Cacna1s	A	T	1: 136,105,844	M1020L	possibly damaging	Het
Cbx8	C	A	11: 119,040,387	R25L	possibly damaging	Het
Ccdc87	A	G	19: 4,841,379	Y633C	probably benign	Het
Col4a4	C	T	1: 82,507,031	S505N	unknown	Het
Cyp2b9	T	A	7: 26,173,574	D47E	probably benign	Het
Dnah3	A	C	7: 120,009,384	M1784R	probably damaging	Het
Dnah8	T	A	17: 30,747,854	L2520*	probably null	Het
E2f2	A	G	4: 136,178,485	E103G	possibly damaging	Het
Eef1akmt3	T	A	10: 127,033,008	H199L	possibly damaging	Het
Faxc	A	T	4: 21,993,376	N340I	possibly damaging	Het
Fer1l6	A	T	15: 58,625,177	R1199*	probably null	Het
Fer1l6	A	G	15: 58,638,006	D1439G	probably damaging	Het
Galnt5	G	T	2: 58,035,249	W847C	probably damaging	Het
Gbp2	G	A	3: 142,632,032	S303N	probably benign	Het
Glipr1l1	A	T	10: 112,060,427	K40*	probably null	Het
Gm4353	A	C	7: 116,083,899	L149R	possibly damaging	Het
Grk5	A	G	19: 61,089,942	D479G	probably damaging	Het
Gzmc	T	A	14: 56,234,029		probably null	Het
Hace1	T	C	10: 45,648,890	Y251H	probably benign	Het
Hhla1	G	T	15: 65,941,797	P229T	probably damaging	Het
Hspa1l	C	T	17: 34,977,452	Q156*	probably null	Het
Igkv4-78	A	T	6: 69,059,699	Y117N	probably benign	Het
Ikzf3	C	A	11: 98,467,053	R486L	probably damaging	Het
Itpr1	C	T	6: 108,378,203	T485M	possibly damaging	Het
Kcnab3	T	C	11: 69,328,575	Y131H	probably benign	Het
Kcnu1	C	T	8: 25,932,334	P209L	probably benign	Het
Klk8	T	A	7: 43,798,670	C39*	probably null	Het
Mbtps1	A	G	8: 119,528,961	L519P	probably damaging	Het
Mgat4a	A	G	1: 37,456,592	I287T	probably damaging	Het
Mindy2	T	C	9: 70,605,198	E590G	possibly damaging	Het
Mllt11	G	T	3: 95,220,291	T56K	probably benign	Het
Myo5b	G	A	18: 74,742,178	R1551H	probably damaging	Het
Nmrk2	T	C	10: 81,200,962	T16A	possibly damaging	Het
Olfr324	T	A	11: 58,598,005	F203Y	probably damaging	Het
Olfr862	G	T	9: 19,884,069	P79T	probably damaging	Het
Osbpl9	T	C	4: 109,156,702	D65G	probably damaging	Het
Phf2	T	A	13: 48,803,655	K1079*	probably null	Het
Plcb1	A	G	2: 135,370,566	S1026G	possibly damaging	Het
Pnrc2	A	T	4: 135,872,086	H117Q	probably benign	Het
Ppfia2	A	T	10: 106,913,594	I1114F	probably damaging	Het
Rpl12	G	A	2: 32,962,988	E72K	probably benign	Het
Sbf1	C	T	15: 89,293,476	R1642H	probably benign	Het
Sephs2	G	A	7: 127,273,946		probably benign	Het
Slc35c2	A	T	2: 165,280,697	L194H	probably damaging	Het
Slfn4	T	A	11: 83,189,112	Y150N	probably damaging	Het
Srbd1	T	C	17: 85,985,295	R949G	probably damaging	Het
Urah	T	A	7: 140,835,705	S28T	probably damaging	Het
Wdr62	A	G	7: 30,242,435	S649P	probably damaging	Het
Wnk1	C	A	6: 119,952,767	G1263V	probably damaging	Het
Zbtb4	C	A	11: 69,778,243	D114E	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- AACGTCTGTGCACTGGACAG -3'
(R):5'- CCTGCTGTCTAATACTTGTATAACC -3'

Sequencing Primer
(F):5'- TGCACTGGACAGCTGGGAG -3'
(R):5'- TGTCTAATACTTGTATAACCTTTGGC -3'

Posted On

2018-02-28