Incidental Mutation 'R6237:E2f2'
ID504988
Institutional Source Beutler Lab
Gene Symbol E2f2
Ensembl Gene ENSMUSG00000018983
Gene NameE2F transcription factor 2
Synonyms
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R6237 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136172394-136196057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136178485 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 103 (E103G)
Ref Sequence ENSEMBL: ENSMUSP00000050047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061721
AA Change: E103G

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050047
Gene: ENSMUSG00000018983
AA Change: E103G

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
E2F_TDP 131 196 2.93e-32 SMART
Pfam:E2F_CC-MB 212 306 3.1e-38 PFAM
low complexity region 348 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149750
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F1 and E2F3, have an additional cyclin binding domain. This protein binds specifically to retinoblastoma protein pRB in a cell-cycle dependent manner, and it exhibits overall 46% amino acid identity to E2F1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death with signs of inflammatory and autoimmune disorders such as increased memory T cells, enlarged spleen, glomerulonephritis, inflammed liver, inflammed lung, increased double stranded DNA antibodies, hair loss, and erythema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah3 A C 7: 120,009,384 M1784R probably damaging Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
Eef1akmt3 T A 10: 127,033,008 H199L possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Galnt5 G T 2: 58,035,249 W847C probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Hspa1l C T 17: 34,977,452 Q156* probably null Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Ikzf3 C A 11: 98,467,053 R486L probably damaging Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sbf1 C T 15: 89,293,476 R1642H probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Wnk1 C A 6: 119,952,767 G1263V probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in E2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:E2f2 APN 4 136180417 nonsense probably null
IGL02078:E2f2 APN 4 136193012 missense probably damaging 1.00
IGL02112:E2f2 APN 4 136192834 missense probably benign 0.08
IGL02123:E2f2 APN 4 136172848 missense probably benign 0.00
R0398:E2f2 UTSW 4 136180544 missense probably damaging 1.00
R1594:E2f2 UTSW 4 136186830 missense possibly damaging 0.85
R4729:E2f2 UTSW 4 136184449 missense probably damaging 0.99
R5092:E2f2 UTSW 4 136186937 missense probably benign 0.04
R5184:E2f2 UTSW 4 136184440 missense possibly damaging 0.95
R5462:E2f2 UTSW 4 136172913 missense probably benign 0.06
R5987:E2f2 UTSW 4 136172934 missense probably benign 0.00
R7678:E2f2 UTSW 4 136192826 nonsense probably null
R8247:E2f2 UTSW 4 136172815 missense possibly damaging 0.76
R8261:E2f2 UTSW 4 136184480 synonymous silent
Predicted Primers PCR Primer
(F):5'- GCTGACACTTCCTCACCAAG -3'
(R):5'- CGTGAGAATACACAAGAAACCTTG -3'

Sequencing Primer
(F):5'- TCCTCACCAAGTTCAGCCGG -3'
(R):5'- CCTTGGAAAAGGGAATTGTCTG -3'
Posted On2018-02-28