Incidental Mutation 'R6237:Wnk1'
ID 504991
Institutional Source Beutler Lab
Gene Symbol Wnk1
Ensembl Gene ENSMUSG00000045962
Gene Name WNK lysine deficient protein kinase 1
Synonyms 6430573H23Rik, Hsn2, EG406236, Prkwnk1
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6237 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 119923969-120038672 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 119952767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 1263 (G1263V)
Ref Sequence ENSEMBL: ENSMUSP00000086017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060043] [ENSMUST00000088644] [ENSMUST00000088646] [ENSMUST00000160686] [ENSMUST00000203030] [ENSMUST00000177761]
AlphaFold P83741
Predicted Effect probably damaging
Transcript: ENSMUST00000060043
AA Change: G1005V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063001
Gene: ENSMUSG00000045962
AA Change: G1005V

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.5e-44 PFAM
Pfam:Pkinase 221 479 4.4e-58 PFAM
Pfam:OSR1_C 500 537 2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 865 876 N/A INTRINSIC
low complexity region 1018 1028 N/A INTRINSIC
low complexity region 1042 1058 N/A INTRINSIC
internal_repeat_1 1136 1178 2.15e-5 PROSPERO
low complexity region 1289 1305 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1398 1428 N/A INTRINSIC
low complexity region 1429 1454 N/A INTRINSIC
low complexity region 1496 1515 N/A INTRINSIC
low complexity region 1542 1556 N/A INTRINSIC
low complexity region 1586 1609 N/A INTRINSIC
low complexity region 1670 1691 N/A INTRINSIC
low complexity region 1698 1712 N/A INTRINSIC
low complexity region 1738 1764 N/A INTRINSIC
low complexity region 1882 1900 N/A INTRINSIC
coiled coil region 2065 2092 N/A INTRINSIC
low complexity region 2103 2114 N/A INTRINSIC
low complexity region 2116 2140 N/A INTRINSIC
low complexity region 2208 2232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088644
AA Change: G1263V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086017
Gene: ENSMUSG00000045962
AA Change: G1263V

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 5.5e-44 PFAM
Pfam:Pkinase 221 479 4.3e-56 PFAM
Pfam:OSR1_C 500 537 1.9e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1146 1158 N/A INTRINSIC
low complexity region 1276 1286 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
internal_repeat_1 1394 1436 2.19e-5 PROSPERO
low complexity region 1547 1563 N/A INTRINSIC
low complexity region 1603 1615 N/A INTRINSIC
low complexity region 1637 1654 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
low complexity region 1687 1712 N/A INTRINSIC
low complexity region 1754 1773 N/A INTRINSIC
low complexity region 1800 1814 N/A INTRINSIC
low complexity region 1844 1867 N/A INTRINSIC
low complexity region 1928 1949 N/A INTRINSIC
low complexity region 1956 1970 N/A INTRINSIC
low complexity region 1996 2022 N/A INTRINSIC
low complexity region 2140 2158 N/A INTRINSIC
coiled coil region 2323 2350 N/A INTRINSIC
low complexity region 2361 2372 N/A INTRINSIC
low complexity region 2374 2398 N/A INTRINSIC
low complexity region 2466 2490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088646
AA Change: G851V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000086019
Gene: ENSMUSG00000045962
AA Change: G851V

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.3e-44 PFAM
Pfam:Pkinase 221 479 4e-58 PFAM
Pfam:OSR1_C 500 537 1.8e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 864 874 N/A INTRINSIC
low complexity region 888 904 N/A INTRINSIC
internal_repeat_1 982 1024 7.56e-6 PROSPERO
low complexity region 1135 1151 N/A INTRINSIC
low complexity region 1191 1203 N/A INTRINSIC
low complexity region 1225 1242 N/A INTRINSIC
low complexity region 1244 1274 N/A INTRINSIC
low complexity region 1275 1300 N/A INTRINSIC
low complexity region 1342 1361 N/A INTRINSIC
low complexity region 1388 1402 N/A INTRINSIC
low complexity region 1432 1455 N/A INTRINSIC
low complexity region 1516 1537 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1584 1610 N/A INTRINSIC
low complexity region 1700 1718 N/A INTRINSIC
coiled coil region 1883 1910 N/A INTRINSIC
low complexity region 1921 1932 N/A INTRINSIC
low complexity region 1934 1958 N/A INTRINSIC
low complexity region 2026 2050 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159397
Predicted Effect possibly damaging
Transcript: ENSMUST00000159785
AA Change: G145V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124905
Gene: ENSMUSG00000045962
AA Change: G145V

DomainStartEndE-ValueType
low complexity region 159 169 N/A INTRINSIC
low complexity region 183 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160686
SMART Domains Protein: ENSMUSP00000137334
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 102 115 N/A INTRINSIC
low complexity region 119 128 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160769
Predicted Effect probably benign
Transcript: ENSMUST00000161048
SMART Domains Protein: ENSMUSP00000125345
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
Blast:S_TKc 2 68 3e-34 BLAST
SCOP:d1phk__ 3 70 2e-7 SMART
Pfam:OSR1_C 89 126 9.5e-21 PFAM
coiled coil region 151 185 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161185
Predicted Effect probably benign
Transcript: ENSMUST00000161802
SMART Domains Protein: ENSMUSP00000124724
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162368
SMART Domains Protein: ENSMUSP00000125383
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162541
SMART Domains Protein: ENSMUSP00000125193
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 63 84 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 131 157 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204207
Predicted Effect probably benign
Transcript: ENSMUST00000203030
SMART Domains Protein: ENSMUSP00000145304
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 4.1e-44 PFAM
Pfam:Pkinase 221 479 3.2e-56 PFAM
Pfam:OSR1_C 500 537 1.5e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 793 809 N/A INTRINSIC
internal_repeat_1 887 929 5.8e-6 PROSPERO
low complexity region 1040 1056 N/A INTRINSIC
low complexity region 1096 1108 N/A INTRINSIC
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1149 1179 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1247 1266 N/A INTRINSIC
low complexity region 1293 1307 N/A INTRINSIC
low complexity region 1337 1360 N/A INTRINSIC
low complexity region 1421 1442 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1489 1515 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
coiled coil region 1816 1843 N/A INTRINSIC
low complexity region 1854 1865 N/A INTRINSIC
low complexity region 1867 1891 N/A INTRINSIC
low complexity region 1959 1983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177761
SMART Domains Protein: ENSMUSP00000136777
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.7e-44 PFAM
Pfam:Pkinase 221 479 5.1e-58 PFAM
Pfam:OSR1_C 500 537 2.2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
low complexity region 828 839 N/A INTRINSIC
low complexity region 1005 1021 N/A INTRINSIC
low complexity region 1136 1149 N/A INTRINSIC
low complexity region 1153 1162 N/A INTRINSIC
low complexity region 1232 1244 N/A INTRINSIC
low complexity region 1291 1307 N/A INTRINSIC
internal_repeat_1 1385 1427 1.91e-5 PROSPERO
low complexity region 1538 1554 N/A INTRINSIC
low complexity region 1594 1606 N/A INTRINSIC
low complexity region 1628 1645 N/A INTRINSIC
low complexity region 1647 1677 N/A INTRINSIC
low complexity region 1678 1703 N/A INTRINSIC
low complexity region 1745 1764 N/A INTRINSIC
low complexity region 1791 1805 N/A INTRINSIC
low complexity region 1835 1858 N/A INTRINSIC
low complexity region 1919 1940 N/A INTRINSIC
low complexity region 1947 1961 N/A INTRINSIC
low complexity region 1987 2013 N/A INTRINSIC
low complexity region 2131 2149 N/A INTRINSIC
coiled coil region 2314 2341 N/A INTRINSIC
low complexity region 2352 2363 N/A INTRINSIC
low complexity region 2365 2389 N/A INTRINSIC
low complexity region 2457 2481 N/A INTRINSIC
Meta Mutation Damage Score 0.2459 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die before birth, whereas heterozygotes survive and exhibit decreased blood pressure. Mice homozygous for an allele that does not produce the kidney isoform exhibit a slight increase in systemic arterial diastolic blood pressure and reduced sensitivity to amiloride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah3 A C 7: 120,009,384 M1784R probably damaging Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
E2f2 A G 4: 136,178,485 E103G possibly damaging Het
Eef1akmt3 T A 10: 127,033,008 H199L possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Galnt5 G T 2: 58,035,249 W847C probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Hspa1l C T 17: 34,977,452 Q156* probably null Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Ikzf3 C A 11: 98,467,053 R486L probably damaging Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sbf1 C T 15: 89,293,476 R1642H probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in Wnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Wnk1 APN 6 119960708 missense probably damaging 1.00
IGL01364:Wnk1 APN 6 119937411 missense probably damaging 1.00
IGL01715:Wnk1 APN 6 119948397 missense probably damaging 1.00
IGL01951:Wnk1 APN 6 119963485 missense probably damaging 0.99
IGL02043:Wnk1 APN 6 119949078 unclassified probably benign
IGL02268:Wnk1 APN 6 119937373 nonsense probably null
IGL02348:Wnk1 APN 6 119963328 missense probably damaging 0.98
IGL02425:Wnk1 APN 6 119963454 missense probably damaging 1.00
IGL02850:Wnk1 APN 6 119937862 missense probably benign 0.26
IGL03160:Wnk1 APN 6 119926633 missense probably damaging 1.00
IGL03387:Wnk1 APN 6 119954187 missense possibly damaging 0.76
IGL03405:Wnk1 APN 6 119953895 missense probably benign 0.41
Actor UTSW 6 119970978 missense probably damaging 1.00
Bad UTSW 6 119965678 intron probably benign
Blink UTSW 6 120002273 nonsense probably null
Knock UTSW 6 119943878 splice site probably null
Narrow UTSW 6 119992408 missense probably damaging 1.00
nictitate UTSW 6 120002280 missense possibly damaging 0.88
opportunity UTSW 6 119951068 missense probably damaging 1.00
path UTSW 6 120037149 missense probably damaging 0.99
Stormy UTSW 6 119992447 missense probably damaging 1.00
tear UTSW 6 119963470 missense probably damaging 0.98
Tic UTSW 6 119950083 missense probably damaging 1.00
Unforgiving UTSW 6 119948282 missense probably damaging 1.00
Window UTSW 6 119992453 missense probably damaging 1.00
Woke UTSW 6 119962955 missense probably benign 0.12
IGL03052:Wnk1 UTSW 6 119944799 splice site probably benign
PIT4480001:Wnk1 UTSW 6 119963367 nonsense probably null
R0044:Wnk1 UTSW 6 120037149 missense probably damaging 0.99
R0207:Wnk1 UTSW 6 119952733 missense probably damaging 1.00
R0333:Wnk1 UTSW 6 119928163 intron probably benign
R0453:Wnk1 UTSW 6 119963151 missense probably damaging 0.99
R0457:Wnk1 UTSW 6 119969332 missense probably damaging 1.00
R0501:Wnk1 UTSW 6 119962803 missense probably damaging 1.00
R0525:Wnk1 UTSW 6 119926564 missense probably damaging 1.00
R0526:Wnk1 UTSW 6 119951992 missense probably damaging 0.99
R0606:Wnk1 UTSW 6 119926683 missense probably damaging 1.00
R0658:Wnk1 UTSW 6 119948505 missense probably damaging 0.98
R1148:Wnk1 UTSW 6 119952006 splice site probably benign
R1188:Wnk1 UTSW 6 119948709 nonsense probably null
R1245:Wnk1 UTSW 6 119948457 missense probably benign 0.26
R1449:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R1469:Wnk1 UTSW 6 119950684 splice site probably benign
R1869:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1871:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1928:Wnk1 UTSW 6 119952923 missense probably damaging 1.00
R1959:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1961:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1964:Wnk1 UTSW 6 119934382 missense possibly damaging 0.86
R1983:Wnk1 UTSW 6 119937578 missense probably damaging 1.00
R2062:Wnk1 UTSW 6 119928157 splice site probably null
R2144:Wnk1 UTSW 6 119948988 unclassified probably benign
R2186:Wnk1 UTSW 6 119948567 missense probably benign 0.26
R2281:Wnk1 UTSW 6 119963640 splice site probably null
R2338:Wnk1 UTSW 6 119969534 missense probably benign 0.42
R2420:Wnk1 UTSW 6 119936367 critical splice donor site probably null
R3727:Wnk1 UTSW 6 119992453 missense probably damaging 1.00
R3773:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R3836:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3837:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3847:Wnk1 UTSW 6 119969354 missense possibly damaging 0.70
R3903:Wnk1 UTSW 6 119949051 missense probably damaging 1.00
R4031:Wnk1 UTSW 6 119951068 missense probably damaging 1.00
R4095:Wnk1 UTSW 6 119948126 missense probably damaging 1.00
R4232:Wnk1 UTSW 6 119949261 missense possibly damaging 0.90
R4422:Wnk1 UTSW 6 119953895 missense probably benign 0.41
R4423:Wnk1 UTSW 6 119926426 missense probably damaging 1.00
R4572:Wnk1 UTSW 6 119951911 missense possibly damaging 0.49
R4704:Wnk1 UTSW 6 119965744 missense possibly damaging 0.83
R4755:Wnk1 UTSW 6 119963470 missense probably damaging 0.98
R4812:Wnk1 UTSW 6 119952771 missense probably benign 0.16
R4822:Wnk1 UTSW 6 119962438 missense probably benign 0.02
R4879:Wnk1 UTSW 6 119949377 missense probably damaging 1.00
R4970:Wnk1 UTSW 6 119965735 intron probably benign
R5002:Wnk1 UTSW 6 119937963 missense probably benign 0.13
R5037:Wnk1 UTSW 6 119965735 intron probably benign
R5152:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R5257:Wnk1 UTSW 6 120037188 missense probably benign 0.00
R5354:Wnk1 UTSW 6 119968523 missense probably benign 0.01
R5421:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R5564:Wnk1 UTSW 6 119948891 unclassified probably benign
R5600:Wnk1 UTSW 6 119949358 missense probably damaging 1.00
R5847:Wnk1 UTSW 6 119992408 missense probably damaging 1.00
R6083:Wnk1 UTSW 6 120037601 missense probably damaging 0.99
R6110:Wnk1 UTSW 6 119972997 intron probably benign
R6128:Wnk1 UTSW 6 119963786 splice site probably null
R6341:Wnk1 UTSW 6 119948585 missense probably damaging 1.00
R6467:Wnk1 UTSW 6 119962955 missense probably benign 0.12
R6696:Wnk1 UTSW 6 119948282 missense probably damaging 1.00
R6888:Wnk1 UTSW 6 119948781 missense probably benign 0.26
R6923:Wnk1 UTSW 6 119965678 intron probably benign
R7024:Wnk1 UTSW 6 119965726 intron probably benign
R7072:Wnk1 UTSW 6 119937861 missense unknown
R7087:Wnk1 UTSW 6 120037530 missense possibly damaging 0.94
R7102:Wnk1 UTSW 6 119948307 missense unknown
R7134:Wnk1 UTSW 6 119926428 missense unknown
R7137:Wnk1 UTSW 6 120038212 unclassified probably benign
R7142:Wnk1 UTSW 6 119949279 missense probably benign 0.09
R7174:Wnk1 UTSW 6 119970978 missense probably damaging 1.00
R7205:Wnk1 UTSW 6 119943878 splice site probably null
R7218:Wnk1 UTSW 6 120002273 nonsense probably null
R7498:Wnk1 UTSW 6 119927196 missense unknown
R7599:Wnk1 UTSW 6 119929828 missense possibly damaging 0.83
R7615:Wnk1 UTSW 6 119932738 missense probably benign 0.27
R7799:Wnk1 UTSW 6 119949176 missense probably benign 0.04
R7979:Wnk1 UTSW 6 120037448 missense probably damaging 1.00
R8075:Wnk1 UTSW 6 119932714 missense probably damaging 0.99
R8331:Wnk1 UTSW 6 119953833 missense probably benign 0.09
R8343:Wnk1 UTSW 6 119963493 missense probably damaging 0.99
R8348:Wnk1 UTSW 6 119929999 splice site probably null
R8359:Wnk1 UTSW 6 119992447 missense probably damaging 1.00
R8424:Wnk1 UTSW 6 119934427 missense unknown
R8519:Wnk1 UTSW 6 119950083 missense probably damaging 1.00
R8930:Wnk1 UTSW 6 119963265 missense probably damaging 0.99
R8932:Wnk1 UTSW 6 119963265 missense probably damaging 0.99
R8933:Wnk1 UTSW 6 120036998 missense probably damaging 1.00
R9005:Wnk1 UTSW 6 119962432 missense probably damaging 1.00
R9147:Wnk1 UTSW 6 119948670 missense unknown
R9148:Wnk1 UTSW 6 119948670 missense unknown
R9354:Wnk1 UTSW 6 119965699 missense unknown
R9379:Wnk1 UTSW 6 119951717 missense probably damaging 1.00
X0064:Wnk1 UTSW 6 120037032 missense possibly damaging 0.93
Z1177:Wnk1 UTSW 6 119948205 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCATTTCATTCTGCTGTAAGAC -3'
(R):5'- CCTCATTTCTGTCACAGGGC -3'

Sequencing Primer
(F):5'- TTCATTCTGCTGTAAGACAAAGTC -3'
(R):5'- GGGCTTCCCATCTCGACTG -3'
Posted On 2018-02-28