Incidental Mutation 'R6237:Eef1akmt3'
ID505008
Institutional Source Beutler Lab
Gene Symbol Eef1akmt3
Ensembl Gene ENSMUSG00000080115
Gene NameEEF1A lysine methyltransferase 3
SynonymsMettl21b, Gm16109, Fam119b, EG546486
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6237 (G1)
Quality Score207.009
Status Validated
Chromosome10
Chromosomal Location127031004-127041513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127033008 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 199 (H199L)
Ref Sequence ENSEMBL: ENSMUSP00000111939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040560] [ENSMUST00000116231] [ENSMUST00000120547] [ENSMUST00000152054]
Predicted Effect probably benign
Transcript: ENSMUST00000040560
SMART Domains Protein: ENSMUSP00000042134
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
Pfam:EF_TS 115 273 9.6e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116231
AA Change: H199L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111939
Gene: ENSMUSG00000080115
AA Change: H199L

DomainStartEndE-ValueType
Pfam:Methyltransf_16 35 198 4.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120547
SMART Domains Protein: ENSMUSP00000113446
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 3.4e-10 PFAM
Pfam:EF_TS 101 192 1.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145476
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah3 A C 7: 120,009,384 M1784R probably damaging Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
E2f2 A G 4: 136,178,485 E103G possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Galnt5 G T 2: 58,035,249 W847C probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Hspa1l C T 17: 34,977,452 Q156* probably null Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Ikzf3 C A 11: 98,467,053 R486L probably damaging Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sbf1 C T 15: 89,293,476 R1642H probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Wnk1 C A 6: 119,952,767 G1263V probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in Eef1akmt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Eef1akmt3 APN 10 127041083 missense probably benign
IGL02346:Eef1akmt3 APN 10 127032936 missense probably benign
R0158:Eef1akmt3 UTSW 10 127033273 nonsense probably null
R2171:Eef1akmt3 UTSW 10 127032974 missense probably benign 0.00
R4930:Eef1akmt3 UTSW 10 127041355 missense possibly damaging 0.88
R5437:Eef1akmt3 UTSW 10 127033247 missense probably damaging 1.00
R6043:Eef1akmt3 UTSW 10 127033278 missense probably damaging 1.00
R7206:Eef1akmt3 UTSW 10 127040993 missense probably damaging 1.00
R7820:Eef1akmt3 UTSW 10 127033194 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGCCATTCCTAACAAGCAGC -3'
(R):5'- GAAACTATGACTTGGTGCTGGG -3'

Sequencing Primer
(F):5'- CTGCATCTTCCCAAGAGTAGTTAAGG -3'
(R):5'- GGGCGGATATCGTGTACC -3'
Posted On2018-02-28