Incidental Mutation 'R6237:Ikzf3'
ID 505013
Institutional Source Beutler Lab
Gene Symbol Ikzf3
Ensembl Gene ENSMUSG00000018168
Gene Name IKAROS family zinc finger 3
Synonyms Zfpn1a3, Aiolos, 5830411O07Rik
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6237 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 98464902-98546031 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 98467053 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 486 (R486L)
Ref Sequence ENSEMBL: ENSMUSP00000099430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103141]
AlphaFold O08900
Predicted Effect probably damaging
Transcript: ENSMUST00000103141
AA Change: R486L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099430
Gene: ENSMUSG00000018168
AA Change: R486L

DomainStartEndE-ValueType
ZnF_C2H2 117 139 4.34e0 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 4.47e-3 SMART
ZnF_C2H2 201 221 7.11e0 SMART
ZnF_C2H2 450 472 7.11e0 SMART
ZnF_C2H2 478 502 1.64e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153902
Meta Mutation Damage Score 0.8517 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutants exhibit greatly reduced B cell populations in the peritoneum, marginal zone and recirculating bone marrow. Aging mutants express autoantibodies, frequently develop B cell lymphomas, and display symptoms characteristic of SLE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah3 A C 7: 120,009,384 M1784R probably damaging Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
E2f2 A G 4: 136,178,485 E103G possibly damaging Het
Eef1akmt3 T A 10: 127,033,008 H199L possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Galnt5 G T 2: 58,035,249 W847C probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Hspa1l C T 17: 34,977,452 Q156* probably null Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sbf1 C T 15: 89,293,476 R1642H probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Wnk1 C A 6: 119,952,767 G1263V probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in Ikzf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Ikzf3 APN 11 98488857 missense probably damaging 1.00
IGL01537:Ikzf3 APN 11 98516892 missense probably damaging 1.00
IGL03376:Ikzf3 APN 11 98488953 missense probably damaging 1.00
R0030:Ikzf3 UTSW 11 98467612 missense probably benign 0.01
R0266:Ikzf3 UTSW 11 98467317 missense probably benign
R1302:Ikzf3 UTSW 11 98516920 missense probably benign
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1500:Ikzf3 UTSW 11 98518695 missense probably benign 0.16
R1531:Ikzf3 UTSW 11 98490446 missense probably damaging 0.98
R1599:Ikzf3 UTSW 11 98467093 missense probably damaging 1.00
R1623:Ikzf3 UTSW 11 98490331 critical splice donor site probably null
R2154:Ikzf3 UTSW 11 98485649 nonsense probably null
R3915:Ikzf3 UTSW 11 98490586 missense probably damaging 1.00
R4004:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4005:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4075:Ikzf3 UTSW 11 98467643 nonsense probably null
R4210:Ikzf3 UTSW 11 98490487 missense probably benign 0.00
R4804:Ikzf3 UTSW 11 98490574 missense probably benign 0.20
R5107:Ikzf3 UTSW 11 98490476 missense probably damaging 1.00
R5266:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5267:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5450:Ikzf3 UTSW 11 98467086 missense probably damaging 1.00
R6557:Ikzf3 UTSW 11 98516881 missense probably benign
R7832:Ikzf3 UTSW 11 98518699 missense probably benign
R8058:Ikzf3 UTSW 11 98516927 nonsense probably null
R8073:Ikzf3 UTSW 11 98467429 missense probably benign 0.05
R9564:Ikzf3 UTSW 11 98467206 missense probably damaging 1.00
Z1176:Ikzf3 UTSW 11 98467181 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGATTGAGAGCTAACAGAACTGG -3'
(R):5'- TGGGATGCCTCTTCTGAAGG -3'

Sequencing Primer
(F):5'- CTAACAGAACTGGGTGGGACTGTG -3'
(R):5'- ATGCCTCTTCTGAAGGAGGTCC -3'
Posted On 2018-02-28