Mutagenetix > Incidental Mutation

Incidental Mutation 'R6237:Ikzf3'

505013

Institutional Source

Beutler Lab

Gene Symbol

Ikzf3

Ensembl Gene

ENSMUSG00000018168

Gene Name

IKAROS family zinc finger 3

Synonyms

Zfpn1a3, Aiolos, 5830411O07Rik

MMRRC Submission

044362-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6237 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98464902-98546031 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 98467053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 486 (R486L)

Ref Sequence

ENSEMBL: ENSMUSP00000099430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103141]

AlphaFold

O08900

Predicted Effect

probably damaging
Transcript: ENSMUST00000103141
AA Change: R486L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099430
Gene: ENSMUSG00000018168
AA Change: R486L

Domain	Start	End	E-Value	Type
ZnF_C2H2	117	139	4.34e0	SMART
ZnF_C2H2	145	167	8.02e-5	SMART
ZnF_C2H2	173	195	4.47e-3	SMART
ZnF_C2H2	201	221	7.11e0	SMART
ZnF_C2H2	450	472	7.11e0	SMART
ZnF_C2H2	478	502	1.64e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153902

Meta Mutation Damage Score

0.8517

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutants exhibit greatly reduced B cell populations in the peritoneum, marginal zone and recirculating bone marrow. Aging mutants express autoantibodies, frequently develop B cell lymphomas, and display symptoms characteristic of SLE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 119,615,763	R380H	probably damaging	Het
Akr1c12	C	A	13: 4,275,768	D109Y	possibly damaging	Het
Cacna1s	A	T	1: 136,105,844	M1020L	possibly damaging	Het
Cbx8	C	A	11: 119,040,387	R25L	possibly damaging	Het
Ccdc87	A	G	19: 4,841,379	Y633C	probably benign	Het
Col4a4	C	T	1: 82,507,031	S505N	unknown	Het
Cr2	T	A	1: 195,157,502	H539L	probably damaging	Het
Cyp2b9	T	A	7: 26,173,574	D47E	probably benign	Het
Dnah3	A	C	7: 120,009,384	M1784R	probably damaging	Het
Dnah8	T	A	17: 30,747,854	L2520*	probably null	Het
E2f2	A	G	4: 136,178,485	E103G	possibly damaging	Het
Eef1akmt3	T	A	10: 127,033,008	H199L	possibly damaging	Het
Faxc	A	T	4: 21,993,376	N340I	possibly damaging	Het
Fer1l6	A	T	15: 58,625,177	R1199*	probably null	Het
Fer1l6	A	G	15: 58,638,006	D1439G	probably damaging	Het
Galnt5	G	T	2: 58,035,249	W847C	probably damaging	Het
Gbp2	G	A	3: 142,632,032	S303N	probably benign	Het
Glipr1l1	A	T	10: 112,060,427	K40*	probably null	Het
Gm4353	A	C	7: 116,083,899	L149R	possibly damaging	Het
Grk5	A	G	19: 61,089,942	D479G	probably damaging	Het
Gzmc	T	A	14: 56,234,029		probably null	Het
Hace1	T	C	10: 45,648,890	Y251H	probably benign	Het
Hhla1	G	T	15: 65,941,797	P229T	probably damaging	Het
Hspa1l	C	T	17: 34,977,452	Q156*	probably null	Het
Igkv4-78	A	T	6: 69,059,699	Y117N	probably benign	Het
Itpr1	C	T	6: 108,378,203	T485M	possibly damaging	Het
Kcnab3	T	C	11: 69,328,575	Y131H	probably benign	Het
Kcnu1	C	T	8: 25,932,334	P209L	probably benign	Het
Klk8	T	A	7: 43,798,670	C39*	probably null	Het
Mbtps1	A	G	8: 119,528,961	L519P	probably damaging	Het
Mgat4a	A	G	1: 37,456,592	I287T	probably damaging	Het
Mindy2	T	C	9: 70,605,198	E590G	possibly damaging	Het
Mllt11	G	T	3: 95,220,291	T56K	probably benign	Het
Myo5b	G	A	18: 74,742,178	R1551H	probably damaging	Het
Nmrk2	T	C	10: 81,200,962	T16A	possibly damaging	Het
Olfr324	T	A	11: 58,598,005	F203Y	probably damaging	Het
Olfr862	G	T	9: 19,884,069	P79T	probably damaging	Het
Osbpl9	T	C	4: 109,156,702	D65G	probably damaging	Het
Phf2	T	A	13: 48,803,655	K1079*	probably null	Het
Plcb1	A	G	2: 135,370,566	S1026G	possibly damaging	Het
Pnrc2	A	T	4: 135,872,086	H117Q	probably benign	Het
Ppfia2	A	T	10: 106,913,594	I1114F	probably damaging	Het
Rpl12	G	A	2: 32,962,988	E72K	probably benign	Het
Sbf1	C	T	15: 89,293,476	R1642H	probably benign	Het
Sephs2	G	A	7: 127,273,946		probably benign	Het
Slc35c2	A	T	2: 165,280,697	L194H	probably damaging	Het
Slfn4	T	A	11: 83,189,112	Y150N	probably damaging	Het
Srbd1	T	C	17: 85,985,295	R949G	probably damaging	Het
Urah	T	A	7: 140,835,705	S28T	probably damaging	Het
Wdr62	A	G	7: 30,242,435	S649P	probably damaging	Het
Wnk1	C	A	6: 119,952,767	G1263V	probably damaging	Het
Zbtb4	C	A	11: 69,778,243	D114E	possibly damaging	Het

Other mutations in Ikzf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01477:Ikzf3	APN	11	98488857	missense	probably damaging	1.00
IGL01537:Ikzf3	APN	11	98516892	missense	probably damaging	1.00
IGL03376:Ikzf3	APN	11	98488953	missense	probably damaging	1.00
R0030:Ikzf3	UTSW	11	98467612	missense	probably benign	0.01
R0266:Ikzf3	UTSW	11	98467317	missense	probably benign
R1302:Ikzf3	UTSW	11	98516920	missense	probably benign
R1464:Ikzf3	UTSW	11	98516905	missense	probably benign	0.00
R1464:Ikzf3	UTSW	11	98516905	missense	probably benign	0.00
R1500:Ikzf3	UTSW	11	98518695	missense	probably benign	0.16
R1531:Ikzf3	UTSW	11	98490446	missense	probably damaging	0.98
R1599:Ikzf3	UTSW	11	98467093	missense	probably damaging	1.00
R1623:Ikzf3	UTSW	11	98490331	critical splice donor site	probably null
R2154:Ikzf3	UTSW	11	98485649	nonsense	probably null
R3915:Ikzf3	UTSW	11	98490586	missense	probably damaging	1.00
R4004:Ikzf3	UTSW	11	98489017	missense	probably damaging	1.00
R4005:Ikzf3	UTSW	11	98489017	missense	probably damaging	1.00
R4075:Ikzf3	UTSW	11	98467643	nonsense	probably null
R4210:Ikzf3	UTSW	11	98490487	missense	probably benign	0.00
R4804:Ikzf3	UTSW	11	98490574	missense	probably benign	0.20
R5107:Ikzf3	UTSW	11	98490476	missense	probably damaging	1.00
R5266:Ikzf3	UTSW	11	98490580	missense	probably benign	0.11
R5267:Ikzf3	UTSW	11	98490580	missense	probably benign	0.11
R5450:Ikzf3	UTSW	11	98467086	missense	probably damaging	1.00
R6557:Ikzf3	UTSW	11	98516881	missense	probably benign
R7832:Ikzf3	UTSW	11	98518699	missense	probably benign
R8058:Ikzf3	UTSW	11	98516927	nonsense	probably null
R8073:Ikzf3	UTSW	11	98467429	missense	probably benign	0.05
R9564:Ikzf3	UTSW	11	98467206	missense	probably damaging	1.00
Z1176:Ikzf3	UTSW	11	98467181	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CATGATTGAGAGCTAACAGAACTGG -3'
(R):5'- TGGGATGCCTCTTCTGAAGG -3'

Sequencing Primer
(F):5'- CTAACAGAACTGGGTGGGACTGTG -3'
(R):5'- ATGCCTCTTCTGAAGGAGGTCC -3'

Posted On

2018-02-28