Incidental Mutation 'R6237:Sbf1'
ID 505021
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene Name SET binding factor 1
Synonyms B230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock # R6237 (G1)
Quality Score 194.009
Status Validated
Chromosome 15
Chromosomal Location 89288236-89315311 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89293476 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1642 (R1642H)
Ref Sequence ENSEMBL: ENSMUSP00000120725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585]
AlphaFold Q6ZPE2
Predicted Effect probably benign
Transcript: ENSMUST00000123791
AA Change: R1642H

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: R1642H

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124398
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144585
AA Change: R1668H

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: R1668H

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000175778
AA Change: R189H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177388
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah3 A C 7: 120,009,384 M1784R probably damaging Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
E2f2 A G 4: 136,178,485 E103G possibly damaging Het
Eef1akmt3 T A 10: 127,033,008 H199L possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Galnt5 G T 2: 58,035,249 W847C probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Hspa1l C T 17: 34,977,452 Q156* probably null Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Ikzf3 C A 11: 98,467,053 R486L probably damaging Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Wnk1 C A 6: 119,952,767 G1263V probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89305575 missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89299743 missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89288716 missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89303278 missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89303215 unclassified probably benign
IGL01908:Sbf1 APN 15 89302726 missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89289044 missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89302505 nonsense probably null
IGL02150:Sbf1 APN 15 89295480 missense probably benign 0.00
IGL02284:Sbf1 APN 15 89305078 missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89307572 missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89305985 unclassified probably benign
IGL03025:Sbf1 APN 15 89289645 missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89293947 missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89289105 missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89289016 unclassified probably benign
IGL03397:Sbf1 APN 15 89288721 missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89295561 missense probably benign 0.26
R0139:Sbf1 UTSW 15 89302498 missense probably damaging 1.00
R0528:Sbf1 UTSW 15 89288712 missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89302329 missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89304716 missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89305076 missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89294425 missense probably damaging 1.00
R2025:Sbf1 UTSW 15 89302730 missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89306693 missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R2845:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R3788:Sbf1 UTSW 15 89299528 nonsense probably null
R4108:Sbf1 UTSW 15 89288585 unclassified probably benign
R4403:Sbf1 UTSW 15 89293954 missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89303481 missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89306926 missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89295246 missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89303112 nonsense probably null
R4697:Sbf1 UTSW 15 89315085 missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89302713 missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89288634 missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89308068 missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89305611 missense probably damaging 1.00
R6256:Sbf1 UTSW 15 89300867 missense probably benign 0.06
R6490:Sbf1 UTSW 15 89304908 missense probably benign
R6933:Sbf1 UTSW 15 89300369 missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89305420 missense possibly damaging 0.52
R7921:Sbf1 UTSW 15 89306223 missense probably damaging 0.96
R8005:Sbf1 UTSW 15 89294205 missense probably damaging 0.98
R8350:Sbf1 UTSW 15 89299509 missense probably damaging 0.99
R8450:Sbf1 UTSW 15 89299509 missense probably damaging 0.99
R8509:Sbf1 UTSW 15 89293457 missense probably damaging 1.00
R8753:Sbf1 UTSW 15 89295459 missense probably benign
R8788:Sbf1 UTSW 15 89301859 missense probably damaging 1.00
R9182:Sbf1 UTSW 15 89289603 critical splice donor site probably null
R9516:Sbf1 UTSW 15 89300539 missense probably damaging 1.00
R9608:Sbf1 UTSW 15 89307605 critical splice acceptor site probably null
R9673:Sbf1 UTSW 15 89295472 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CACAGCTATCCCAAGTATGTAAGC -3'
(R):5'- TGCGACCCTACAGCAATGTG -3'

Sequencing Primer
(F):5'- CCCAAGTATGTAAGCAGTTCACATGG -3'
(R):5'- CTACAGCAATGTGTCCAATCTGAAGG -3'
Posted On 2018-02-28