Mutagenetix > Incidental Mutation

Incidental Mutation 'R6237:Sbf1'

505021

Institutional Source

Beutler Lab

Gene Symbol

Sbf1

Ensembl Gene

ENSMUSG00000036529

Gene Name

SET binding factor 1

Synonyms

B230113C15Rik, 2610510A08Rik, Mtmr5

MMRRC Submission

044362-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.506) question?

Stock #

R6237 (G1)

Quality Score

194.009

Status

Validated

Chromosome

Chromosomal Location

89288236-89315311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89293476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1642 (R1642H)

Ref Sequence

ENSEMBL: ENSMUSP00000120725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585]

AlphaFold

Q6ZPE2

Predicted Effect

probably benign
Transcript: ENSMUST00000123791
AA Change: R1642H

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: R1642H

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	540	764	4.1e-110	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1100	1534	6.2e-114	PFAM
low complexity region	1614	1621	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	1719	1750	N/A	INTRINSIC
PH	1762	1867	6.45e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124398

Predicted Effect

probably benign
Transcript: ENSMUST00000124576

SMART Domains

Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
Pfam:dDENN	363	403	4.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144585
AA Change: R1668H

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: R1668H

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	542	764	2.3e-108	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1106	1558	5.7e-93	PFAM
low complexity region	1640	1647	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
low complexity region	1745	1776	N/A	INTRINSIC
PH	1788	1893	6.45e-17	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000175778
AA Change: R189H

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177388

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 119,615,763	R380H	probably damaging	Het
Akr1c12	C	A	13: 4,275,768	D109Y	possibly damaging	Het
Cacna1s	A	T	1: 136,105,844	M1020L	possibly damaging	Het
Cbx8	C	A	11: 119,040,387	R25L	possibly damaging	Het
Ccdc87	A	G	19: 4,841,379	Y633C	probably benign	Het
Col4a4	C	T	1: 82,507,031	S505N	unknown	Het
Cr2	T	A	1: 195,157,502	H539L	probably damaging	Het
Cyp2b9	T	A	7: 26,173,574	D47E	probably benign	Het
Dnah3	A	C	7: 120,009,384	M1784R	probably damaging	Het
Dnah8	T	A	17: 30,747,854	L2520*	probably null	Het
E2f2	A	G	4: 136,178,485	E103G	possibly damaging	Het
Eef1akmt3	T	A	10: 127,033,008	H199L	possibly damaging	Het
Faxc	A	T	4: 21,993,376	N340I	possibly damaging	Het
Fer1l6	A	T	15: 58,625,177	R1199*	probably null	Het
Fer1l6	A	G	15: 58,638,006	D1439G	probably damaging	Het
Galnt5	G	T	2: 58,035,249	W847C	probably damaging	Het
Gbp2	G	A	3: 142,632,032	S303N	probably benign	Het
Glipr1l1	A	T	10: 112,060,427	K40*	probably null	Het
Gm4353	A	C	7: 116,083,899	L149R	possibly damaging	Het
Grk5	A	G	19: 61,089,942	D479G	probably damaging	Het
Gzmc	T	A	14: 56,234,029		probably null	Het
Hace1	T	C	10: 45,648,890	Y251H	probably benign	Het
Hhla1	G	T	15: 65,941,797	P229T	probably damaging	Het
Hspa1l	C	T	17: 34,977,452	Q156*	probably null	Het
Igkv4-78	A	T	6: 69,059,699	Y117N	probably benign	Het
Ikzf3	C	A	11: 98,467,053	R486L	probably damaging	Het
Itpr1	C	T	6: 108,378,203	T485M	possibly damaging	Het
Kcnab3	T	C	11: 69,328,575	Y131H	probably benign	Het
Kcnu1	C	T	8: 25,932,334	P209L	probably benign	Het
Klk8	T	A	7: 43,798,670	C39*	probably null	Het
Mbtps1	A	G	8: 119,528,961	L519P	probably damaging	Het
Mgat4a	A	G	1: 37,456,592	I287T	probably damaging	Het
Mindy2	T	C	9: 70,605,198	E590G	possibly damaging	Het
Mllt11	G	T	3: 95,220,291	T56K	probably benign	Het
Myo5b	G	A	18: 74,742,178	R1551H	probably damaging	Het
Nmrk2	T	C	10: 81,200,962	T16A	possibly damaging	Het
Olfr324	T	A	11: 58,598,005	F203Y	probably damaging	Het
Olfr862	G	T	9: 19,884,069	P79T	probably damaging	Het
Osbpl9	T	C	4: 109,156,702	D65G	probably damaging	Het
Phf2	T	A	13: 48,803,655	K1079*	probably null	Het
Plcb1	A	G	2: 135,370,566	S1026G	possibly damaging	Het
Pnrc2	A	T	4: 135,872,086	H117Q	probably benign	Het
Ppfia2	A	T	10: 106,913,594	I1114F	probably damaging	Het
Rpl12	G	A	2: 32,962,988	E72K	probably benign	Het
Sephs2	G	A	7: 127,273,946		probably benign	Het
Slc35c2	A	T	2: 165,280,697	L194H	probably damaging	Het
Slfn4	T	A	11: 83,189,112	Y150N	probably damaging	Het
Srbd1	T	C	17: 85,985,295	R949G	probably damaging	Het
Urah	T	A	7: 140,835,705	S28T	probably damaging	Het
Wdr62	A	G	7: 30,242,435	S649P	probably damaging	Het
Wnk1	C	A	6: 119,952,767	G1263V	probably damaging	Het
Zbtb4	C	A	11: 69,778,243	D114E	possibly damaging	Het

Other mutations in Sbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00265:Sbf1	APN	15	89305575	missense	probably damaging	0.98
IGL01478:Sbf1	APN	15	89299743	missense	probably damaging	0.97
IGL01533:Sbf1	APN	15	89288716	missense	probably damaging	0.99
IGL01603:Sbf1	APN	15	89303278	missense	probably damaging	1.00
IGL01758:Sbf1	APN	15	89303215	unclassified	probably benign
IGL01908:Sbf1	APN	15	89302726	missense	probably damaging	1.00
IGL02067:Sbf1	APN	15	89289044	missense	probably damaging	1.00
IGL02089:Sbf1	APN	15	89302505	nonsense	probably null
IGL02150:Sbf1	APN	15	89295480	missense	probably benign	0.00
IGL02284:Sbf1	APN	15	89305078	missense	probably damaging	1.00
IGL02367:Sbf1	APN	15	89307572	missense	probably damaging	0.99
IGL02427:Sbf1	APN	15	89305985	unclassified	probably benign
IGL03025:Sbf1	APN	15	89289645	missense	probably damaging	1.00
IGL03103:Sbf1	APN	15	89293947	missense	probably damaging	1.00
IGL03226:Sbf1	APN	15	89289105	missense	possibly damaging	0.93
IGL03376:Sbf1	APN	15	89289016	unclassified	probably benign
IGL03397:Sbf1	APN	15	89288721	missense	probably damaging	1.00
R0043:Sbf1	UTSW	15	89295561	missense	probably benign	0.26
R0139:Sbf1	UTSW	15	89302498	missense	probably damaging	1.00
R0528:Sbf1	UTSW	15	89288712	missense	probably damaging	0.99
R0624:Sbf1	UTSW	15	89302329	missense	possibly damaging	0.68
R0759:Sbf1	UTSW	15	89304716	missense	probably damaging	1.00
R1555:Sbf1	UTSW	15	89305076	missense	probably damaging	1.00
R1763:Sbf1	UTSW	15	89294425	missense	probably damaging	1.00
R2025:Sbf1	UTSW	15	89302730	missense	probably damaging	1.00
R2207:Sbf1	UTSW	15	89306693	missense	possibly damaging	0.88
R2844:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R2845:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R3788:Sbf1	UTSW	15	89299528	nonsense	probably null
R4108:Sbf1	UTSW	15	89288585	unclassified	probably benign
R4403:Sbf1	UTSW	15	89293954	missense	possibly damaging	0.94
R4605:Sbf1	UTSW	15	89303481	missense	probably damaging	1.00
R4620:Sbf1	UTSW	15	89306926	missense	probably damaging	0.99
R4666:Sbf1	UTSW	15	89295246	missense	probably damaging	1.00
R4696:Sbf1	UTSW	15	89303112	nonsense	probably null
R4697:Sbf1	UTSW	15	89315085	missense	possibly damaging	0.71
R4747:Sbf1	UTSW	15	89302713	missense	probably damaging	1.00
R5828:Sbf1	UTSW	15	89288634	missense	probably damaging	1.00
R5841:Sbf1	UTSW	15	89308068	missense	probably damaging	1.00
R6185:Sbf1	UTSW	15	89305611	missense	probably damaging	1.00
R6256:Sbf1	UTSW	15	89300867	missense	probably benign	0.06
R6490:Sbf1	UTSW	15	89304908	missense	probably benign
R6933:Sbf1	UTSW	15	89300369	missense	probably damaging	1.00
R7806:Sbf1	UTSW	15	89305420	missense	possibly damaging	0.52
R7921:Sbf1	UTSW	15	89306223	missense	probably damaging	0.96
R8005:Sbf1	UTSW	15	89294205	missense	probably damaging	0.98
R8350:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8450:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8509:Sbf1	UTSW	15	89293457	missense	probably damaging	1.00
R8753:Sbf1	UTSW	15	89295459	missense	probably benign
R8788:Sbf1	UTSW	15	89301859	missense	probably damaging	1.00
R9182:Sbf1	UTSW	15	89289603	critical splice donor site	probably null
R9516:Sbf1	UTSW	15	89300539	missense	probably damaging	1.00
R9608:Sbf1	UTSW	15	89307605	critical splice acceptor site	probably null
R9673:Sbf1	UTSW	15	89295472	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- CACAGCTATCCCAAGTATGTAAGC -3'
(R):5'- TGCGACCCTACAGCAATGTG -3'

Sequencing Primer
(F):5'- CCCAAGTATGTAAGCAGTTCACATGG -3'
(R):5'- CTACAGCAATGTGTCCAATCTGAAGG -3'

Posted On

2018-02-28