Mutagenetix > Incidental Mutations

Incidental Mutation 'R6237:Hspa1l'

505023

Institutional Source

Beutler Lab

Gene Symbol

Hspa1l

Ensembl Gene

ENSMUSG00000007033

Gene Name

heat shock protein 1-like

Synonyms

70kDa, Msh5, Hsc70t

MMRRC Submission

044362-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.676) question?

Stock #

R6237 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34972703-34979285 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 34977452 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 156 (Q156*)

Ref Sequence

ENSEMBL: ENSMUSP00000007248 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000007266] [ENSMUST00000114011] [ENSMUST00000173004]

Predicted Effect

probably null
Transcript: ENSMUST00000007248
AA Change: Q156*

SMART Domains

Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033
AA Change: Q156*

Domain	Start	End	E-Value	Type
Pfam:HSP70	8	614	6.5e-269	PFAM
low complexity region	616	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000007266

SMART Domains

Protein: ENSMUSP00000007266
Gene: ENSMUSG00000007050

Domain	Start	End	E-Value	Type
Sm	41	108	8.91e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114011

SMART Domains

Protein: ENSMUSP00000109644
Gene: ENSMUSG00000007050

Domain	Start	End	E-Value	Type
Sm	5	72	8.91e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172890

Predicted Effect

probably benign
Transcript: ENSMUST00000173004

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174241

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174860

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 119,615,763	R380H	probably damaging	Het
Akr1c12	C	A	13: 4,275,768	D109Y	possibly damaging	Het
Cacna1s	A	T	1: 136,105,844	M1020L	possibly damaging	Het
Cbx8	C	A	11: 119,040,387	R25L	possibly damaging	Het
Ccdc87	A	G	19: 4,841,379	Y633C	probably benign	Het
Col4a4	C	T	1: 82,507,031	S505N	unknown	Het
Cr2	T	A	1: 195,157,502	H539L	probably damaging	Het
Cyp2b9	T	A	7: 26,173,574	D47E	probably benign	Het
Dnah3	A	C	7: 120,009,384	M1784R	probably damaging	Het
Dnah8	T	A	17: 30,747,854	L2520*	probably null	Het
E2f2	A	G	4: 136,178,485	E103G	possibly damaging	Het
Eef1akmt3	T	A	10: 127,033,008	H199L	possibly damaging	Het
Faxc	A	T	4: 21,993,376	N340I	possibly damaging	Het
Fer1l6	A	T	15: 58,625,177	R1199*	probably null	Het
Fer1l6	A	G	15: 58,638,006	D1439G	probably damaging	Het
Galnt5	G	T	2: 58,035,249	W847C	probably damaging	Het
Gbp2	G	A	3: 142,632,032	S303N	probably benign	Het
Glipr1l1	A	T	10: 112,060,427	K40*	probably null	Het
Gm4353	A	C	7: 116,083,899	L149R	possibly damaging	Het
Grk5	A	G	19: 61,089,942	D479G	probably damaging	Het
Gzmc	T	A	14: 56,234,029		probably null	Het
Hace1	T	C	10: 45,648,890	Y251H	probably benign	Het
Hhla1	G	T	15: 65,941,797	P229T	probably damaging	Het
Igkv4-78	A	T	6: 69,059,699	Y117N	probably benign	Het
Ikzf3	C	A	11: 98,467,053	R486L	probably damaging	Het
Itpr1	C	T	6: 108,378,203	T485M	possibly damaging	Het
Kcnab3	T	C	11: 69,328,575	Y131H	probably benign	Het
Kcnu1	C	T	8: 25,932,334	P209L	probably benign	Het
Klk8	T	A	7: 43,798,670	C39*	probably null	Het
Mbtps1	A	G	8: 119,528,961	L519P	probably damaging	Het
Mgat4a	A	G	1: 37,456,592	I287T	probably damaging	Het
Mindy2	T	C	9: 70,605,198	E590G	possibly damaging	Het
Mllt11	G	T	3: 95,220,291	T56K	probably benign	Het
Myo5b	G	A	18: 74,742,178	R1551H	probably damaging	Het
Nmrk2	T	C	10: 81,200,962	T16A	possibly damaging	Het
Olfr324	T	A	11: 58,598,005	F203Y	probably damaging	Het
Olfr862	G	T	9: 19,884,069	P79T	probably damaging	Het
Osbpl9	T	C	4: 109,156,702	D65G	probably damaging	Het
Phf2	T	A	13: 48,803,655	K1079*	probably null	Het
Plcb1	A	G	2: 135,370,566	S1026G	possibly damaging	Het
Pnrc2	A	T	4: 135,872,086	H117Q	probably benign	Het
Ppfia2	A	T	10: 106,913,594	I1114F	probably damaging	Het
Rpl12	G	A	2: 32,962,988	E72K	probably benign	Het
Sbf1	C	T	15: 89,293,476	R1642H	probably benign	Het
Sephs2	G	A	7: 127,273,946		probably benign	Het
Slc35c2	A	T	2: 165,280,697	L194H	probably damaging	Het
Slfn4	T	A	11: 83,189,112	Y150N	probably damaging	Het
Srbd1	T	C	17: 85,985,295	R949G	probably damaging	Het
Urah	T	A	7: 140,835,705	S28T	probably damaging	Het
Wdr62	A	G	7: 30,242,435	S649P	probably damaging	Het
Wnk1	C	A	6: 119,952,767	G1263V	probably damaging	Het
Zbtb4	C	A	11: 69,778,243	D114E	possibly damaging	Het

Other mutations in Hspa1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Hspa1l	APN	17	34977465	missense	probably damaging	1.00
IGL01548:Hspa1l	APN	17	34978391	missense	probably damaging	0.98
IGL01860:Hspa1l	APN	17	34978811	missense	probably benign	0.00
IGL01959:Hspa1l	APN	17	34977135	missense	probably damaging	1.00
IGL02661:Hspa1l	APN	17	34977275	missense	probably benign
R0355:Hspa1l	UTSW	17	34977410	missense	probably benign
R0850:Hspa1l	UTSW	17	34977623	missense	probably benign	0.01
R1675:Hspa1l	UTSW	17	34977443	missense	probably damaging	1.00
R2148:Hspa1l	UTSW	17	34977390	missense	probably damaging	0.98
R2169:Hspa1l	UTSW	17	34977323	missense	probably benign
R2418:Hspa1l	UTSW	17	34977188	missense	probably benign	0.05
R4323:Hspa1l	UTSW	17	34977856	nonsense	probably null
R4924:Hspa1l	UTSW	17	34977856	nonsense	probably null
R4926:Hspa1l	UTSW	17	34978223	missense	possibly damaging	0.92
R5186:Hspa1l	UTSW	17	34978469	missense	probably damaging	0.97
R5653:Hspa1l	UTSW	17	34977420	missense	probably damaging	1.00
R5790:Hspa1l	UTSW	17	34977240	missense	probably benign	0.08
R6086:Hspa1l	UTSW	17	34978155	missense	possibly damaging	0.77
R7229:Hspa1l	UTSW	17	34977255	missense	probably benign	0.05
Z1176:Hspa1l	UTSW	17	34978492	missense	possibly damaging	0.52
Z1177:Hspa1l	UTSW	17	34978016	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- ATGATCCTGTTGTGCAGTCAGATATG -3'
(R):5'- ATCGTCAGGATGGACACGTC -3'

Sequencing Primer
(F):5'- CAGTCAGATATGAAGCTTTGGCC -3'
(R):5'- GTCGAACGTGCCACCCC -3'

Posted On

2018-02-28