Incidental Mutation 'R6238:Rfx8'
ID505028
Institutional Source Beutler Lab
Gene Symbol Rfx8
Ensembl Gene ENSMUSG00000057173
Gene Nameregulatory factor X 8
Synonyms4933400N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location39665301-39720997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39670394 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 491 (S491I)
Ref Sequence ENSEMBL: ENSMUSP00000121212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151913]
Predicted Effect probably damaging
Transcript: ENSMUST00000151913
AA Change: S491I

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121212
Gene: ENSMUSG00000057173
AA Change: S491I

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 17 94 6.5e-31 PFAM
Blast:DEXDc 301 358 4e-8 BLAST
low complexity region 445 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Rfx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Rfx8 APN 1 39682950 nonsense probably null
IGL01659:Rfx8 APN 1 39670573 missense probably damaging 1.00
IGL02239:Rfx8 APN 1 39680886 missense probably benign 0.00
IGL02302:Rfx8 APN 1 39665522 missense possibly damaging 0.50
IGL02332:Rfx8 APN 1 39718480 missense possibly damaging 0.89
IGL02598:Rfx8 APN 1 39695968 splice site probably benign
IGL02870:Rfx8 APN 1 39683711 missense possibly damaging 0.94
IGL03403:Rfx8 APN 1 39690173 missense possibly damaging 0.94
PIT4515001:Rfx8 UTSW 1 39690105 missense probably benign 0.04
R0060:Rfx8 UTSW 1 39718405 splice site probably benign
R0095:Rfx8 UTSW 1 39685536 missense possibly damaging 0.58
R0265:Rfx8 UTSW 1 39688577 missense possibly damaging 0.67
R1892:Rfx8 UTSW 1 39670586 splice site probably null
R2054:Rfx8 UTSW 1 39685559 missense possibly damaging 0.92
R2960:Rfx8 UTSW 1 39682952 missense probably damaging 1.00
R4554:Rfx8 UTSW 1 39680940 missense probably benign 0.00
R5410:Rfx8 UTSW 1 39710156 critical splice donor site probably null
R5496:Rfx8 UTSW 1 39670347 missense probably benign 0.01
R5502:Rfx8 UTSW 1 39682953 missense probably damaging 1.00
R5916:Rfx8 UTSW 1 39688619 missense probably benign 0.20
R6360:Rfx8 UTSW 1 39680965 missense probably benign
R7593:Rfx8 UTSW 1 39683678 missense probably damaging 1.00
R7738:Rfx8 UTSW 1 39682931 missense probably damaging 1.00
T0722:Rfx8 UTSW 1 39683612 missense probably damaging 1.00
Z1088:Rfx8 UTSW 1 39682966 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTCTCTGTGTGCATGTGTCT -3'
(R):5'- CTTACCGAGTCAGCCCTAGC -3'

Sequencing Primer
(F):5'- GCATGTGTCTGTCTGTCTTGTC -3'
(R):5'- AGGGGTCAAAGTTCAAGTCCCTTC -3'
Posted On2018-02-28