Mutagenetix > Incidental Mutation

Incidental Mutation 'R6238:Cc2d2a'

505043

Institutional Source

Beutler Lab

Gene Symbol

Cc2d2a

Ensembl Gene

ENSMUSG00000039765

Gene Name

coiled-coil and C2 domain containing 2A

Synonyms

b2b1035Clo, 5730509K17Rik

MMRRC Submission

044401-MU

Accession Numbers

Genbank: NM_172274; MGI: 1924487

Essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R6238 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43662346-43740972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43671235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 18 (D18E)

Ref Sequence

ENSEMBL: ENSMUSP00000048320 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]

AlphaFold

Q8CFW7

Predicted Effect

probably benign
Transcript: ENSMUST00000048150
AA Change: D18E

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: D18E

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125866

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142303

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	C	10: 76,449,262	T2P	possibly damaging	Het
2610042L04Rik	A	G	14: 4,348,962	N41S	probably damaging	Het
4933402N03Rik	T	C	7: 131,146,134	D43G	probably benign	Het
Adcy10	C	A	1: 165,575,728	Y1598*	probably null	Het
Adgrv1	G	A	13: 81,466,283	T3997M	probably benign	Het
Amfr	A	C	8: 94,000,364	F74V	probably damaging	Het
Ankrd13a	T	C	5: 114,786,726	Y91H	probably benign	Het
Baiap3	A	G	17: 25,245,758	S767P	probably benign	Het
Car12	C	T	9: 66,753,726	T124I	probably damaging	Het
Casp9	G	T	4: 141,807,137	G286V	probably damaging	Het
Cdc27	T	C	11: 104,528,444	N221D	probably damaging	Het
Cebpz	A	G	17: 78,936,910	S41P	possibly damaging	Het
Cenpo	T	A	12: 4,231,968	S10C	possibly damaging	Het
Chid1	A	G	7: 141,496,136	V368A	probably benign	Het
Clca1	C	A	3: 145,008,955	V634L	probably benign	Het
Cmtr1	A	G	17: 29,682,148	D683G	probably damaging	Het
Cpsf3	G	T	12: 21,300,162	R294L	probably damaging	Het
Ddrgk1	G	A	2: 130,654,679	T255M	possibly damaging	Het
Dennd6a	T	A	14: 26,616,658		probably null	Het
Dnah10	A	G	5: 124,743,679	R526G	probably damaging	Het
Dock3	G	A	9: 106,912,948	T1484I	probably benign	Het
Efcab10	T	C	12: 33,398,434	Y89H	probably damaging	Het
Etl4	T	A	2: 20,801,568	D1200E	probably damaging	Het
Fbn1	T	A	2: 125,324,945	D2017V	probably damaging	Het
Ftmt	G	A	18: 52,332,235	V208M	probably damaging	Het
Fzd10	T	C	5: 128,602,931	Y572H	probably damaging	Het
Gcc1	T	C	6: 28,420,743	K39E	probably damaging	Het
Hydin	A	G	8: 110,392,111		probably null	Het
Lif	A	G	11: 4,268,940	E73G	possibly damaging	Het
Lrtm1	C	A	14: 29,027,671	Q357K	probably benign	Het
Mef2d	T	A	3: 88,159,545	L205Q	probably damaging	Het
Naalad2	T	A	9: 18,385,065	E96D	probably damaging	Het
Nbas	T	C	12: 13,482,595	I1768T	probably benign	Het
Nodal	T	C	10: 61,423,479	S232P	probably damaging	Het
Olfr598	A	T	7: 103,328,908	I141F	possibly damaging	Het
Olfr876	A	G	9: 37,804,021	T37A	probably benign	Het
Parl	G	A	16: 20,302,213	R39C	possibly damaging	Het
Pcdha9	G	A	18: 36,998,975	V366I	probably benign	Het
Pdzd8	A	G	19: 59,300,562	V802A	probably benign	Het
Plcl2	T	C	17: 50,606,845	V294A	probably damaging	Het
Plxna2	T	A	1: 194,790,196	S1083T	probably benign	Het
Polr2a	G	T	11: 69,747,221	L141I	possibly damaging	Het
Ptpre	C	A	7: 135,671,180	R468S	probably damaging	Het
Raet1e	T	A	10: 22,180,871	N115K	probably benign	Het
Rfx8	C	A	1: 39,670,394	S491I	probably damaging	Het
Rpe	T	A	1: 66,701,648	L48*	probably null	Het
Skint5	A	T	4: 113,942,867		probably null	Het
Spata24	C	A	18: 35,660,336	S111I	possibly damaging	Het
Suz12	G	C	11: 80,002,180		probably benign	Het
Taf4	T	A	2: 179,932,039	I679F	probably damaging	Het
Tlr1	G	T	5: 64,927,129	P35Q	possibly damaging	Het
Tonsl	T	C	15: 76,636,218		probably null	Het
Tsen54	G	A	11: 115,820,687	R310H	probably benign	Het
Ttc7b	A	G	12: 100,495,422	S99P	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uhmk1	T	A	1: 170,199,994	N378I	probably damaging	Het
Vmn2r107	A	G	17: 20,345,587	T55A	probably benign	Het
Vmn2r74	C	T	7: 85,952,072	C786Y	probably damaging	Het
Wdr20rt	C	T	12: 65,226,190		probably benign	Het
Zfand2a	T	A	5: 139,481,991	H42L	probably damaging	Het
Zfp990	T	A	4: 145,537,913	C494S	probably damaging	Het
Zkscan4	A	T	13: 21,484,587	R403W	possibly damaging	Het

Other mutations in Cc2d2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cc2d2a	APN	5	43724380	splice site	probably benign
IGL00937:Cc2d2a	APN	5	43688122	critical splice acceptor site	probably null
IGL01322:Cc2d2a	APN	5	43689003	missense	probably benign	0.00
IGL01349:Cc2d2a	APN	5	43723784	missense	probably benign	0.01
IGL01448:Cc2d2a	APN	5	43684185	missense	possibly damaging	0.65
IGL01871:Cc2d2a	APN	5	43688969	missense	probably damaging	0.98
IGL01947:Cc2d2a	APN	5	43688237	missense	probably damaging	0.96
IGL01976:Cc2d2a	APN	5	43683115	missense	probably benign	0.02
IGL02113:Cc2d2a	APN	5	43685248	splice site	probably null
IGL02364:Cc2d2a	APN	5	43735450	missense	probably damaging	1.00
IGL02448:Cc2d2a	APN	5	43683205	splice site	probably benign
IGL02458:Cc2d2a	APN	5	43718554	missense	probably benign	0.01
IGL02542:Cc2d2a	APN	5	43688910	splice site	probably benign
IGL02834:Cc2d2a	APN	5	43714521	nonsense	probably null
IGL02940:Cc2d2a	APN	5	43728294	splice site	probably null
IGL03003:Cc2d2a	APN	5	43671266	missense	probably benign	0.22
IGL03183:Cc2d2a	APN	5	43732379	missense	probably damaging	1.00
C9142:Cc2d2a	UTSW	5	43735457	splice site	probably benign
P0028:Cc2d2a	UTSW	5	43684199	missense	probably benign
R0193:Cc2d2a	UTSW	5	43736118	missense	probably damaging	1.00
R0201:Cc2d2a	UTSW	5	43737512	missense	probably damaging	1.00
R0211:Cc2d2a	UTSW	5	43688266	splice site	probably null
R0243:Cc2d2a	UTSW	5	43696638	splice site	probably benign
R0317:Cc2d2a	UTSW	5	43706901	critical splice donor site	probably null
R0453:Cc2d2a	UTSW	5	43703294	missense	probably benign	0.00
R0558:Cc2d2a	UTSW	5	43724387	splice site	probably benign
R0624:Cc2d2a	UTSW	5	43730029	missense	probably benign
R0634:Cc2d2a	UTSW	5	43681381	splice site	probably benign
R1503:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R1635:Cc2d2a	UTSW	5	43722470	missense	probably damaging	1.00
R1686:Cc2d2a	UTSW	5	43739371	missense	possibly damaging	0.81
R1707:Cc2d2a	UTSW	5	43723688	splice site	probably null
R1715:Cc2d2a	UTSW	5	43718661	missense	probably damaging	0.97
R1765:Cc2d2a	UTSW	5	43714531	missense	probably damaging	0.99
R1794:Cc2d2a	UTSW	5	43688252	missense	probably damaging	1.00
R1881:Cc2d2a	UTSW	5	43740828	missense	probably damaging	0.99
R1917:Cc2d2a	UTSW	5	43706222	missense	probably damaging	1.00
R2005:Cc2d2a	UTSW	5	43726373	critical splice donor site	probably null
R2201:Cc2d2a	UTSW	5	43684033	splice site	probably benign
R2244:Cc2d2a	UTSW	5	43732433	missense	probably damaging	1.00
R2368:Cc2d2a	UTSW	5	43703888	missense	probably benign
R2442:Cc2d2a	UTSW	5	43671305	critical splice donor site	probably null
R2511:Cc2d2a	UTSW	5	43735395	missense	probably damaging	0.99
R3023:Cc2d2a	UTSW	5	43685251	splice site	probably null
R3147:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3148:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3426:Cc2d2a	UTSW	5	43736109	missense	probably benign	0.00
R3609:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3610:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3611:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3839:Cc2d2a	UTSW	5	43718714	missense	probably benign
R3870:Cc2d2a	UTSW	5	43718691	nonsense	probably null
R4334:Cc2d2a	UTSW	5	43683134	missense	probably benign	0.00
R4913:Cc2d2a	UTSW	5	43739323	missense	probably benign	0.12
R5179:Cc2d2a	UTSW	5	43688221	missense	possibly damaging	0.82
R5315:Cc2d2a	UTSW	5	43720433	missense	probably damaging	0.99
R5352:Cc2d2a	UTSW	5	43706213	missense	probably damaging	1.00
R5386:Cc2d2a	UTSW	5	43730041	missense	probably benign	0.01
R5538:Cc2d2a	UTSW	5	43695176	missense	possibly damaging	0.94
R5568:Cc2d2a	UTSW	5	43709091	missense	probably damaging	0.99
R5618:Cc2d2a	UTSW	5	43729907	missense	probably benign	0.00
R5653:Cc2d2a	UTSW	5	43722462	missense	possibly damaging	0.81
R5817:Cc2d2a	UTSW	5	43712418	missense	probably damaging	1.00
R5858:Cc2d2a	UTSW	5	43715775	missense	probably damaging	1.00
R5905:Cc2d2a	UTSW	5	43712426	missense	probably benign
R5912:Cc2d2a	UTSW	5	43720430	missense	probably damaging	0.97
R6073:Cc2d2a	UTSW	5	43729975	missense	probably damaging	1.00
R6084:Cc2d2a	UTSW	5	43668673	missense	probably benign
R6142:Cc2d2a	UTSW	5	43703198	missense	probably damaging	0.97
R6176:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.32
R6381:Cc2d2a	UTSW	5	43715776	missense	possibly damaging	0.69
R6404:Cc2d2a	UTSW	5	43704074	missense	possibly damaging	0.58
R6455:Cc2d2a	UTSW	5	43739412	missense	possibly damaging	0.69
R6695:Cc2d2a	UTSW	5	43718677	missense	probably damaging	0.99
R6805:Cc2d2a	UTSW	5	43681331	missense	probably damaging	1.00
R6919:Cc2d2a	UTSW	5	43703215	missense	probably benign	0.19
R6970:Cc2d2a	UTSW	5	43718585	missense	probably damaging	1.00
R7024:Cc2d2a	UTSW	5	43733929	missense	probably benign	0.10
R7054:Cc2d2a	UTSW	5	43699979	nonsense	probably null
R7071:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.13
R7098:Cc2d2a	UTSW	5	43683139	missense	probably benign	0.00
R7366:Cc2d2a	UTSW	5	43729990	missense	probably damaging	1.00
R7908:Cc2d2a	UTSW	5	43706846	missense	probably benign	0.00
R7920:Cc2d2a	UTSW	5	43739309	missense	probably benign	0.09
R7950:Cc2d2a	UTSW	5	43695296	critical splice donor site	probably null
R8007:Cc2d2a	UTSW	5	43706100	missense	possibly damaging	0.71
R8117:Cc2d2a	UTSW	5	43712439	missense	probably damaging	1.00
R8123:Cc2d2a	UTSW	5	43710554	missense	probably benign
R8179:Cc2d2a	UTSW	5	43699953	missense	probably damaging	0.96
R8279:Cc2d2a	UTSW	5	43736145	missense	probably benign	0.01
R8293:Cc2d2a	UTSW	5	43688228	missense	probably damaging	0.97
R8480:Cc2d2a	UTSW	5	43685144	splice site	probably null
R8482:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R8731:Cc2d2a	UTSW	5	43735446	missense	probably damaging	1.00
R8780:Cc2d2a	UTSW	5	43739350	missense	probably damaging	1.00
R8784:Cc2d2a	UTSW	5	43703303	missense	possibly damaging	0.90
R8871:Cc2d2a	UTSW	5	43699943	missense	possibly damaging	0.71
R8972:Cc2d2a	UTSW	5	43710542	missense	probably benign
R9122:Cc2d2a	UTSW	5	43673739	missense	probably null	0.07
R9125:Cc2d2a	UTSW	5	43703221	missense	probably benign
R9203:Cc2d2a	UTSW	5	43733837	missense	probably benign	0.01
R9310:Cc2d2a	UTSW	5	43695146	missense	probably damaging	1.00
R9343:Cc2d2a	UTSW	5	43718657	missense	probably damaging	1.00
R9353:Cc2d2a	UTSW	5	43703349	critical splice donor site	probably null
Z1177:Cc2d2a	UTSW	5	43703204	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGCCTTAGTACCATCCCATCC -3'
(R):5'- ATTAGCCATCACAGGTGTATCC -3'

Sequencing Primer
(F):5'- CATCCCACTTATTTCAGTTAGAGGAG -3'
(R):5'- GTATCCTGTGTGGCTCCCCAG -3'

Posted On

2018-02-28